EMAIL THIS PAGE TO A FRIEND

STK4

serine/threonine kinase 4

Synonyms: KRS2 MST1 TIIAC YSK3
Gene ID:
Human(6789) Summary: The protein encoded by this gene is a cytoplasmic kinase that is structurally similar to the yeast Ste20p kinase, which acts upstream of the stress-induced mitogen-activated protein kinase cascade. The encoded protein can phosphorylate myelin basic protein and undergoes autophosphorylation. A caspase-cleaved fragment of the encoded protein has been shown to be capable of phosphorylating histone H2B. The particular phosphorylation catalyzed by this protein has been correlated with apoptosis, and it's possible that this protein induces the chromatin condensation observed in this process. [provided by RefSeq, Jul 2008]
Mouse(58231) serine/threonine kinase 4
Rat(311622) serine/threonine kinase 4
chicken(419187) serine/threonine kinase 4
dog(477240) serine/threonine kinase 4
Horse(100070861) serine/threonine kinase 4
domestic cat(101091185) serine/threonine kinase 4
cow(514886) serine/threonine kinase 4
sheep(101110437) serine/threonine kinase 4
naked mole-rat(101704401) serine/threonine kinase 4
Domestic Rabbit(100358822) serine/threonine kinase 4
domestic guinea pig(100715685) serine/threonine kinase 4
270 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006282 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006282 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006282 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_021420 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021420 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021420 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006282 Rosetta Predictions human pricing
NM_001107800 Rosetta Predictions rat pricing
NM_021420 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006282 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00088018 predicted 1127
2 SASI_Hs01_00088021 predicted 476
3 SASI_Hs01_00088022 predicted 369
4 SASI_Hs02_00341260 predicted 1264
5 SASI_Hs01_00088023 predicted 771
6 SASI_Hs01_00088024 predicted 918
7 SASI_Hs01_00088025 predicted 828
8 SASI_Hs01_00088026 predicted 671
9 SASI_Hs01_00088027 predicted 319
10 SASI_Hs02_00341261 predicted 718
11 SASI_Hs01_00088019 predicted 496
12 SASI_Hs01_00088020 predicted 1098
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107800 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00232395 predicted 491
2 SASI_Rn02_00232396 predicted 1112
3 SASI_Rn02_00232397 predicted 729
4 SASI_Rn02_00232398 predicted 296
5 SASI_Rn02_00232399 predicted 1095
6 SASI_Rn02_00232400 predicted 596
7 SASI_Rn02_00232401 predicted 1262
8 SASI_Rn02_00232402 predicted 393
9 SASI_Rn02_00232403 predicted 452
10 SASI_Rn02_00232404 predicted 912
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021420 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00156583 predicted 469
2 SASI_Mm01_00156584 predicted 378
3 SASI_Mm01_00156585 predicted 425
4 SASI_Mm01_00156586 predicted 713
5 SASI_Mm01_00156587 predicted 1328
6 SASI_Mm01_00156588 predicted 1038
7 SASI_Mm01_00156589 predicted 1244
8 SASI_Mm01_00156590 predicted 619
9 SASI_Mm02_00326058 predicted 1252
10 SASI_Mm01_00156592 predicted 287
11 SASI_Mm01_00156591 predicted 898
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006282
VALIDATED
STK4 MISSION shRNA Bacterial Glycerol Stock
serine/threonine kinase 4
Human
17 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000196901    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006282.2-413s1c1
Sequence:CCGGGTTCTGTATCTGATATCATTCCTCGAGGAATGATATCAGATACAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_006282.2-675s1c1
Sequence:CCGGGATTCAGGAAATTGGATACAACTCGAGTTGTATCCAATTTCCTGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194840    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_006282.2-2970s1c1
Sequence:CCGGCCACAACATCTACCAGATATACTCGAGTATATCTGGTAGATGTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006282.2-375s1c1
Sequence:CCGGCACAGACTTATGGATCGTTATCTCGAGATAACGATCCATAAGTCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195305    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006282.2-772s1c1
Sequence:CCGGCATCCAATGAGGGCAATCTTCCTCGAGGAAGATTGCCCTCATTGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_006282.2-829s1c1
Sequence:CCGGCCAGAGCTATGGTCAGATAACCTCGAGGTTATCTGACCATAGCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_006282.2-1128s1c1
Sequence:CCGGCATGACTGATGGAGCCAATACCTCGAGGTATTGGCTCCATCAGTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006282.x-577s1c1
Sequence:CCGGGCCAAGCGGAATACAGTGATACTCGAGTATCACTGTATTCCGCTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006282.x-1478s1c1
Sequence:CCGGCTAAGAAGAGACGGCAACAAACTCGAGTTTGTTGCCGTCTCTTCTTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001622    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_006282.x-1776s1c1
Sequence:CCGGAGTTGAGTGATAGCTGGGAAACTCGAGTTTCCCAGCTATCACTCAACTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_006282.x-287s1c1
Sequence:CCGGGCCCTCATGTAGTCAAATATTCTCGAGAATATTTGACTACATGAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001623    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_006282.x-197s1c1
Sequence:CCGGCCGGCCAGATTGTTGCTATTACTCGAGTAATAGCAACAATCTGGCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279862    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006282.2-375s21c1
Sequence:CCGGCACAGACTTATGGATCGTTATCTCGAGATAACGATCCATAAGTCTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279861    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006282.2-625s21c1
Sequence:CCGGGCCAAGCGGAATACAGTGATACTCGAGTATCACTGTATTCCGCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006282.2-245s21c1
Sequence:CCGGCCGGCCAGATTGTTGCTATTACTCGAGTAATAGCAACAATCTGGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006282.2-829s21c1
Sequence:CCGGCCAGAGCTATGGTCAGATAACCTCGAGGTTATCTGACCATAGCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006282.2-1128s21c1
Sequence:CCGGCATGACTGATGGAGCCAATACCTCGAGGTATTGGCTCCATCAGTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006282
VALIDATED
STK4 MISSION shRNA shRNA Plasmid DNA
serine/threonine kinase 4
Human
17 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000196901    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006282.2-413s1c1
Sequence:CCGGGTTCTGTATCTGATATCATTCCTCGAGGAATGATATCAGATACAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_006282.2-675s1c1
Sequence:CCGGGATTCAGGAAATTGGATACAACTCGAGTTGTATCCAATTTCCTGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194840    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_006282.2-2970s1c1
Sequence:CCGGCCACAACATCTACCAGATATACTCGAGTATATCTGGTAGATGTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006282.2-375s1c1
Sequence:CCGGCACAGACTTATGGATCGTTATCTCGAGATAACGATCCATAAGTCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195305    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006282.2-772s1c1
Sequence:CCGGCATCCAATGAGGGCAATCTTCCTCGAGGAAGATTGCCCTCATTGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_006282.2-829s1c1
Sequence:CCGGCCAGAGCTATGGTCAGATAACCTCGAGGTTATCTGACCATAGCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_006282.2-1128s1c1
Sequence:CCGGCATGACTGATGGAGCCAATACCTCGAGGTATTGGCTCCATCAGTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006282.x-577s1c1
Sequence:CCGGGCCAAGCGGAATACAGTGATACTCGAGTATCACTGTATTCCGCTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006282.x-1478s1c1
Sequence:CCGGCTAAGAAGAGACGGCAACAAACTCGAGTTTGTTGCCGTCTCTTCTTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001622    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_006282.x-1776s1c1
Sequence:CCGGAGTTGAGTGATAGCTGGGAAACTCGAGTTTCCCAGCTATCACTCAACTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_006282.x-287s1c1
Sequence:CCGGGCCCTCATGTAGTCAAATATTCTCGAGAATATTTGACTACATGAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001623    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_006282.x-197s1c1
Sequence:CCGGCCGGCCAGATTGTTGCTATTACTCGAGTAATAGCAACAATCTGGCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279862    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006282.2-375s21c1
Sequence:CCGGCACAGACTTATGGATCGTTATCTCGAGATAACGATCCATAAGTCTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279861    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006282.2-625s21c1
Sequence:CCGGGCCAAGCGGAATACAGTGATACTCGAGTATCACTGTATTCCGCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006282.2-245s21c1
Sequence:CCGGCCGGCCAGATTGTTGCTATTACTCGAGTAATAGCAACAATCTGGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006282.2-829s21c1
Sequence:CCGGCCAGAGCTATGGTCAGATAACCTCGAGGTTATCTGACCATAGCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006282.2-1128s21c1
Sequence:CCGGCATGACTGATGGAGCCAATACCTCGAGGTATTGGCTCCATCAGTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006282
VALIDATED
STK4 MISSION shRNA Lentiviral Transduction Particles
serine/threonine kinase 4
Human
17 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000196901    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006282.2-413s1c1
Sequence:CCGGGTTCTGTATCTGATATCATTCCTCGAGGAATGATATCAGATACAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_006282.2-675s1c1
Sequence:CCGGGATTCAGGAAATTGGATACAACTCGAGTTGTATCCAATTTCCTGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194840    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_006282.2-2970s1c1
Sequence:CCGGCCACAACATCTACCAGATATACTCGAGTATATCTGGTAGATGTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195133    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006282.2-375s1c1
Sequence:CCGGCACAGACTTATGGATCGTTATCTCGAGATAACGATCCATAAGTCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195305    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006282.2-772s1c1
Sequence:CCGGCATCCAATGAGGGCAATCTTCCTCGAGGAAGATTGCCCTCATTGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195454    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_006282.2-829s1c1
Sequence:CCGGCCAGAGCTATGGTCAGATAACCTCGAGGTTATCTGACCATAGCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_006282.2-1128s1c1
Sequence:CCGGCATGACTGATGGAGCCAATACCTCGAGGTATTGGCTCCATCAGTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001625    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006282.x-577s1c1
Sequence:CCGGGCCAAGCGGAATACAGTGATACTCGAGTATCACTGTATTCCGCTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001626    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006282.x-1478s1c1
Sequence:CCGGCTAAGAAGAGACGGCAACAAACTCGAGTTTGTTGCCGTCTCTTCTTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001622    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_006282.x-1776s1c1
Sequence:CCGGAGTTGAGTGATAGCTGGGAAACTCGAGTTTCCCAGCTATCACTCAACTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_006282.x-287s1c1
Sequence:CCGGGCCCTCATGTAGTCAAATATTCTCGAGAATATTTGACTACATGAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001623    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_006282.x-197s1c1
Sequence:CCGGCCGGCCAGATTGTTGCTATTACTCGAGTAATAGCAACAATCTGGCCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279862    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006282.2-375s21c1
Sequence:CCGGCACAGACTTATGGATCGTTATCTCGAGATAACGATCCATAAGTCTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279861    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006282.2-625s21c1
Sequence:CCGGGCCAAGCGGAATACAGTGATACTCGAGTATCACTGTATTCCGCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279921    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006282.2-245s21c1
Sequence:CCGGCCGGCCAGATTGTTGCTATTACTCGAGTAATAGCAACAATCTGGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279919    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006282.2-829s21c1
Sequence:CCGGCCAGAGCTATGGTCAGATAACCTCGAGGTTATCTGACCATAGCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006282.2-1128s21c1
Sequence:CCGGCATGACTGATGGAGCCAATACCTCGAGGTATTGGCTCCATCAGTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021420
VALIDATED
STK4 MISSION shRNA Bacterial Glycerol Stock
serine/threonine kinase 4
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000025284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021420.2-872s1c1
Sequence:CCGGCCGTTTGTTAAGAGTGCCAAACTCGAGTTTGGCACTCTTAACAAACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021420.2-1214s1c1
Sequence:CCGGCCGTCTTTCCTTGAATACTTTCTCGAGAAAGTATTCAAGGAAAGACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021420.2-611s1c1
Sequence:CCGGGCTCCTGAAGTTATTCAGGAACTCGAGTTCCTGAATAACTTCAGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021420.2-718s1c1
Sequence:CCGGCCATCCAATGAGGGCAATATTCTCGAGAATATTGCCCTCATTGGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025285    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021420.2-282s1c1
Sequence:CCGGGCCCTCACGTAGTCAAGTATTCTCGAGAATACTTGACTACGTGAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000323449    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021420.3-1641s21c1
Sequence:CCGGGCCATTTGGTGTGTGCATTTACTCGAGTAAATGCACACACCAAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021420.3-477s21c1
Sequence:CCGGCGAGATATCAAGGCGGGAAATCTCGAGATTTCCCGCCTTGATATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021420.3-380s21c1
Sequence:CCGGGCTACGGAACAAGACGTTAACCTCGAGGTTAACGTCTTGTTCCGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021420.3-280s21c1
Sequence:CCGGGCCCTCACGTAGTCAAGTATTCTCGAGAATACTTGACTACGTGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021420.3-1212s21c1
Sequence:CCGGCCGTCTTTCCTTGAATACTTTCTCGAGAAAGTATTCAAGGAAAGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021420
VALIDATED
STK4 MISSION shRNA shRNA Plasmid DNA
serine/threonine kinase 4
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000025284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021420.2-872s1c1
Sequence:CCGGCCGTTTGTTAAGAGTGCCAAACTCGAGTTTGGCACTCTTAACAAACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021420.2-1214s1c1
Sequence:CCGGCCGTCTTTCCTTGAATACTTTCTCGAGAAAGTATTCAAGGAAAGACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021420.2-611s1c1
Sequence:CCGGGCTCCTGAAGTTATTCAGGAACTCGAGTTCCTGAATAACTTCAGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021420.2-718s1c1
Sequence:CCGGCCATCCAATGAGGGCAATATTCTCGAGAATATTGCCCTCATTGGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025285    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021420.2-282s1c1
Sequence:CCGGGCCCTCACGTAGTCAAGTATTCTCGAGAATACTTGACTACGTGAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000323449    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021420.3-1641s21c1
Sequence:CCGGGCCATTTGGTGTGTGCATTTACTCGAGTAAATGCACACACCAAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021420.3-477s21c1
Sequence:CCGGCGAGATATCAAGGCGGGAAATCTCGAGATTTCCCGCCTTGATATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021420.3-380s21c1
Sequence:CCGGGCTACGGAACAAGACGTTAACCTCGAGGTTAACGTCTTGTTCCGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021420.3-280s21c1
Sequence:CCGGGCCCTCACGTAGTCAAGTATTCTCGAGAATACTTGACTACGTGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021420.3-1212s21c1
Sequence:CCGGCCGTCTTTCCTTGAATACTTTCTCGAGAAAGTATTCAAGGAAAGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021420
VALIDATED
STK4 MISSION shRNA Lentiviral Transduction Particles
serine/threonine kinase 4
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000025284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021420.2-872s1c1
Sequence:CCGGCCGTTTGTTAAGAGTGCCAAACTCGAGTTTGGCACTCTTAACAAACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021420.2-1214s1c1
Sequence:CCGGCCGTCTTTCCTTGAATACTTTCTCGAGAAAGTATTCAAGGAAAGACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025288    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021420.2-611s1c1
Sequence:CCGGGCTCCTGAAGTTATTCAGGAACTCGAGTTCCTGAATAACTTCAGGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021420.2-718s1c1
Sequence:CCGGCCATCCAATGAGGGCAATATTCTCGAGAATATTGCCCTCATTGGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025285    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021420.2-282s1c1
Sequence:CCGGGCCCTCACGTAGTCAAGTATTCTCGAGAATACTTGACTACGTGAGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000323449    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021420.3-1641s21c1
Sequence:CCGGGCCATTTGGTGTGTGCATTTACTCGAGTAAATGCACACACCAAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021420.3-477s21c1
Sequence:CCGGCGAGATATCAAGGCGGGAAATCTCGAGATTTCCCGCCTTGATATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021420.3-380s21c1
Sequence:CCGGGCTACGGAACAAGACGTTAACCTCGAGGTTAACGTCTTGTTCCGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021420.3-280s21c1
Sequence:CCGGGCCCTCACGTAGTCAAGTATTCTCGAGAATACTTGACTACGTGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021420.3-1212s21c1
Sequence:CCGGCCGTCTTTCCTTGAATACTTTCTCGAGAAAGTATTCAAGGAAAGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks