EMAIL THIS PAGE TO A FRIEND

STMN1

stathmin 1

Synonyms: C1orf215 LAP18 Lag OP18 PP17 PP19 PR22 SMN
UniProtKB ID: P16949, A2A2D1, B2R4E7, B7Z8N4, D3DPJ5
Gene ID:
Human(3925) Summary: This gene belongs to the stathmin family of genes. It encodes a ubiquitous cytosolic phosphoprotein proposed to function as an intracellular relay integrating regulatory signals of the cellular environment. The encoded protein is involved in the regulation of the microtubule filament system by destabilizing microtubules. It prevents assembly and promotes disassembly of microtubules. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2009]
Mouse(16765) stathmin 1
Rat(29332) stathmin 1
chicken(396057) stathmin 1
dog(478175) stathmin 1
cow(616317) stathmin 1
sheep(101113917) stathmin 1
125 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
PRS4235 Anti-Op18 (ab1) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution mouse, human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
PRS4237 Anti-Op18 (ab2) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human, rat, mouse
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB4504547 Anti-phospho-Stathmin 1 (pSer15) antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunohistochemistry, western blot pricing
SAB4504548 Anti-phospho-Stathmin 1 (pSer24) antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunohistochemistry, western blot pricing
SAB4504549 Anti-phospho-Stathmin 1 (pSer37) antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, immunohistochemistry, western blot pricing
SAB4300189 Anti-phospho-STMN1 (pSer16) antibody produced in rabbit affinity isolated antibody human, rat, mouse
immunohistochemistry pricing
SAB4300180 Anti-phospho-STMN1 (pSer25) antibody produced in rabbit affinity isolated antibody mouse, human, rat
immunohistochemistry, western blot pricing
SAB4300181 Anti-phospho-STMN1 (pSer38) antibody produced in rabbit affinity isolated antibody rat, human, mouse
immunohistochemistry, western blot pricing
SAB4504597 Anti-phospho-STMN1 (pSer62) antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, western blot pricing
SAB4301284 Anti-phospho-STMN1 (pSer62) antibody produced in rabbit affinity isolated antibody human
immunohistochemistry, western blot pricing
SAB4501733 Anti-Stathmin 1, N-Terminal antibody produced in rabbit affinity isolated antibody human, mouse, rat
immunohistochemistry, western blot pricing
SAB4501734 Anti-Stathmin 1, N-Terminal antibody produced in rabbit affinity isolated antibody human, rat, mouse
immunohistochemistry, western blot pricing
SAB4501735 Anti-Stathmin 1, N-Terminal antibody produced in rabbit affinity isolated antibody rat, mouse, human
immunohistochemistry, western blot pricing
SAB5500178 Anti-Stathmin antibody, Rabbit monoclonal clone SP49, recombinant, expressed in proprietary host, affinity isolated antibody human (tested)
flow cytometry, immunohistochemistry, western blot pricing
SAB4300486 Anti-STMN1 (Ab-16) antibody produced in rabbit affinity isolated antibody human, mouse, rat
immunohistochemistry, western blot pricing
SAB4300476 Anti-STMN1 (Ab-25) antibody produced in rabbit affinity isolated antibody human, rat, mouse
immunofluorescence, immunohistochemistry, western blot pricing
SAB4300477 Anti-STMN1 (Ab-38) antibody produced in rabbit affinity isolated antibody rat, human
immunofluorescence, immunohistochemistry, western blot pricing
SAB4300585 Anti-STMN1 (Ab-62) antibody produced in rabbit affinity isolated antibody human, mouse, rat
immunohistochemistry, western blot pricing
SAB4501736 Anti-STMN1 antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunohistochemistry pricing
SAB2107336 Anti-STMN1 antibody produced in rabbit affinity isolated antibody rabbit, horse, mouse, human, guinea pig
ELISA, western blot pricing
SAB2500996 Anti-STMN1/STATHMIN 1 antibody produced in goat affinity isolated antibody, buffered aqueous solution rat, mouse, human
ELISA, western blot pricing
WH0003925M1 Monoclonal Anti-STMN1 antibody produced in mouse clone 3A9, ascites fluid, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005563 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005563 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005563 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019641 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019641 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019641 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005563 Rosetta Predictions human pricing
NM_203399 Rosetta Predictions human pricing
NM_203401 Rosetta Predictions human pricing
NM_017166 Rosetta Predictions rat pricing
NM_019641 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005563 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00139074 predicted 895
2 SASI_Hs01_00139075 predicted 739
3 SASI_Hs01_00139076 predicted 466
4 SASI_Hs01_00139077 predicted 439
5 SASI_Hs01_00139078 predicted 904
6 SASI_Hs01_00139079 predicted 724
7 SASI_Hs01_00139080 predicted 560
8 SASI_Hs01_00139081 predicted 492
9 SASI_Hs01_00139082 predicted 603
10 SASI_Hs01_00139083 predicted 825
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_203399 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00174159 predicted 866
2 SASI_Hs01_00174160 predicted 707
3 SASI_Hs01_00174161 predicted 436
4 SASI_Hs01_00174162 predicted 417
5 SASI_Hs01_00174163 predicted 889
6 SASI_Hs01_00174164 predicted 695
7 SASI_Hs01_00174165 predicted 531
8 SASI_Hs01_00174166 predicted 463
9 SASI_Hs01_00174167 predicted 584
10 SASI_Hs01_00174168 predicted 804
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_203401 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00142511 predicted 1087
2 SASI_Hs01_00142512 predicted 922
3 SASI_Hs01_00142513 predicted 649
4 SASI_Hs01_00142514 predicted 629
5 SASI_Hs01_00142515 predicted 1092
6 SASI_Hs01_00142516 predicted 909
7 SASI_Hs01_00142517 predicted 741
8 SASI_Hs01_00142518 predicted 680
9 SASI_Hs01_00142519 predicted 791
10 SASI_Hs01_00142520 predicted 1022
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017166 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00053146 predicted 222
2 SASI_Rn01_00053147 predicted 814
3 SASI_Rn01_00053148 predicted 230
4 SASI_Rn02_00261478 predicted 451
5 SASI_Rn01_00053150 predicted 566
6 SASI_Rn02_00261479 predicted 512
7 SASI_Rn01_00053151 predicted 816
8 SASI_Rn02_00261480 predicted 314
9 SASI_Rn01_00053152 predicted 380
10 SASI_Rn02_00261481 predicted 352
11 SASI_Rn01_00053149 predicted 351
12 SASI_Rn01_00053153 predicted 704
13 SASI_Rn01_00053154 predicted 667
14 SASI_Rn01_00053155 predicted 571
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019641 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00099198 predicted 294
2 SASI_Mm01_00099199 predicted 600
3 SASI_Mm01_00099200 predicted 505
4 SASI_Mm01_00099201 predicted 607
5 SASI_Mm01_00099202 predicted 637
6 SASI_Mm01_00099203 predicted 213
7 SASI_Mm01_00099204 predicted 329
8 SASI_Mm01_00099205 predicted 477
9 SASI_Mm01_00099206 predicted 720
10 SASI_Mm01_00099207 predicted 718
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005563
VALIDATED
STMN1 MISSION shRNA Bacterial Glycerol Stock
stathmin 1
Human
17 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_005563.3-545s1c1
Sequence:CCGGGCGAGAGAAGGATAAGCACATCTCGAGATGTGCTTATCCTTCTCTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159246    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005563.3-428s1c1
Sequence:CCGGGAAGGCAATAGAAGAGAACAACTCGAGTTGTTCTCTTCTATTGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160037    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_005563.3-762s1c1
Sequence:CCGGCCAGACTGTAAGATGTTGTTTCTCGAGAAACAACATCTTACAGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160524    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_005563.3-576s1c1
Sequence:CCGGCGGAAGAACAAAGAATCCAAACTCGAGTTTGGATTCTTTGTTCTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160655    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_005563.3-315s1c1
Sequence:CCGGCTGGAGGAAATTCAGAAGAAACTCGAGTTTCTTCTGAATTTCCTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161307    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005563.3-468s1c1
Sequence:CCGGGAAGAGAAACTGACCCACAAACTCGAGTTTGTGGGTCAGTTTCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161497    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_005563.3-1368s1c1
Sequence:CCGGGCGTGTTTCTAGAGAACAGTTCTCGAGAACTGTTCTCTAGAAACACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162139    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005563.3-410s1c1
Sequence:CCGGCGAGAAAGAAGTGCTTCAGAACTCGAGTTCTGAAGCACTTCTTTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162699    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_005563.3-291s1c1
Sequence:CCGGCCTCCAAAGAAGAAGGATCTTCTCGAGAAGATCCTTCTTCTTTGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164665    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_005563.3-1124s1c1
Sequence:CCGGCCCTCCTGGTTGATACTTGTTCTCGAGAACAAGTATCAACCAGGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165568    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_005563.3-405s1c1
Sequence:CCGGGAGCACGAGAAAGAAGTGCTTCTCGAGAAGCACTTCTTTCTCGTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165970    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005563.3-351s1c1
Sequence:CCGGGAAAGACGCAAGTCCCATGAACTCGAGTTCATGGGACTTGCGTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281292    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_005563.3-315s21c1
Sequence:CCGGCTGGAGGAAATTCAGAAGAAACTCGAGTTTCTTCTGAATTTCCTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281294    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_005563.3-762s21c1
Sequence:CCGGCCAGACTGTAAGATGTTGTTTCTCGAGAAACAACATCTTACAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_005563.3-405s21c1
Sequence:CCGGGAGCACGAGAAAGAAGTGCTTCTCGAGAAGCACTTCTTTCTCGTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281293    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_005563.3-1368s21c1
Sequence:CCGGGCGTGTTTCTAGAGAACAGTTCTCGAGAACTGTTCTCTAGAAACACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281370    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_005563.3-545s21c1
Sequence:CCGGGCGAGAGAAGGATAAGCACATCTCGAGATGTGCTTATCCTTCTCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005563
VALIDATED
STMN1 MISSION shRNA shRNA Plasmid DNA
stathmin 1
Human
17 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_005563.3-545s1c1
Sequence:CCGGGCGAGAGAAGGATAAGCACATCTCGAGATGTGCTTATCCTTCTCTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159246    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005563.3-428s1c1
Sequence:CCGGGAAGGCAATAGAAGAGAACAACTCGAGTTGTTCTCTTCTATTGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160037    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_005563.3-762s1c1
Sequence:CCGGCCAGACTGTAAGATGTTGTTTCTCGAGAAACAACATCTTACAGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160524    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_005563.3-576s1c1
Sequence:CCGGCGGAAGAACAAAGAATCCAAACTCGAGTTTGGATTCTTTGTTCTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160655    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_005563.3-315s1c1
Sequence:CCGGCTGGAGGAAATTCAGAAGAAACTCGAGTTTCTTCTGAATTTCCTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161307    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005563.3-468s1c1
Sequence:CCGGGAAGAGAAACTGACCCACAAACTCGAGTTTGTGGGTCAGTTTCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161497    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_005563.3-1368s1c1
Sequence:CCGGGCGTGTTTCTAGAGAACAGTTCTCGAGAACTGTTCTCTAGAAACACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162139    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005563.3-410s1c1
Sequence:CCGGCGAGAAAGAAGTGCTTCAGAACTCGAGTTCTGAAGCACTTCTTTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162699    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_005563.3-291s1c1
Sequence:CCGGCCTCCAAAGAAGAAGGATCTTCTCGAGAAGATCCTTCTTCTTTGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164665    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_005563.3-1124s1c1
Sequence:CCGGCCCTCCTGGTTGATACTTGTTCTCGAGAACAAGTATCAACCAGGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165568    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_005563.3-405s1c1
Sequence:CCGGGAGCACGAGAAAGAAGTGCTTCTCGAGAAGCACTTCTTTCTCGTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165970    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005563.3-351s1c1
Sequence:CCGGGAAAGACGCAAGTCCCATGAACTCGAGTTCATGGGACTTGCGTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281292    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_005563.3-315s21c1
Sequence:CCGGCTGGAGGAAATTCAGAAGAAACTCGAGTTTCTTCTGAATTTCCTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281294    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_005563.3-762s21c1
Sequence:CCGGCCAGACTGTAAGATGTTGTTTCTCGAGAAACAACATCTTACAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_005563.3-405s21c1
Sequence:CCGGGAGCACGAGAAAGAAGTGCTTCTCGAGAAGCACTTCTTTCTCGTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281293    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_005563.3-1368s21c1
Sequence:CCGGGCGTGTTTCTAGAGAACAGTTCTCGAGAACTGTTCTCTAGAAACACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281370    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_005563.3-545s21c1
Sequence:CCGGGCGAGAGAAGGATAAGCACATCTCGAGATGTGCTTATCCTTCTCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005563
VALIDATED
STMN1 MISSION shRNA Lentiviral Transduction Particles
stathmin 1
Human
17 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_005563.3-545s1c1
Sequence:CCGGGCGAGAGAAGGATAAGCACATCTCGAGATGTGCTTATCCTTCTCTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159246    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005563.3-428s1c1
Sequence:CCGGGAAGGCAATAGAAGAGAACAACTCGAGTTGTTCTCTTCTATTGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160037    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_005563.3-762s1c1
Sequence:CCGGCCAGACTGTAAGATGTTGTTTCTCGAGAAACAACATCTTACAGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160524    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_005563.3-576s1c1
Sequence:CCGGCGGAAGAACAAAGAATCCAAACTCGAGTTTGGATTCTTTGTTCTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160655    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_005563.3-315s1c1
Sequence:CCGGCTGGAGGAAATTCAGAAGAAACTCGAGTTTCTTCTGAATTTCCTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161307    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005563.3-468s1c1
Sequence:CCGGGAAGAGAAACTGACCCACAAACTCGAGTTTGTGGGTCAGTTTCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161497    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_005563.3-1368s1c1
Sequence:CCGGGCGTGTTTCTAGAGAACAGTTCTCGAGAACTGTTCTCTAGAAACACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162139    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005563.3-410s1c1
Sequence:CCGGCGAGAAAGAAGTGCTTCAGAACTCGAGTTCTGAAGCACTTCTTTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162699    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_005563.3-291s1c1
Sequence:CCGGCCTCCAAAGAAGAAGGATCTTCTCGAGAAGATCCTTCTTCTTTGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164665    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_005563.3-1124s1c1
Sequence:CCGGCCCTCCTGGTTGATACTTGTTCTCGAGAACAAGTATCAACCAGGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165568    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_005563.3-405s1c1
Sequence:CCGGGAGCACGAGAAAGAAGTGCTTCTCGAGAAGCACTTCTTTCTCGTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165970    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005563.3-351s1c1
Sequence:CCGGGAAAGACGCAAGTCCCATGAACTCGAGTTCATGGGACTTGCGTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281292    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_005563.3-315s21c1
Sequence:CCGGCTGGAGGAAATTCAGAAGAAACTCGAGTTTCTTCTGAATTTCCTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281294    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_005563.3-762s21c1
Sequence:CCGGCCAGACTGTAAGATGTTGTTTCTCGAGAAACAACATCTTACAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281295    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_005563.3-405s21c1
Sequence:CCGGGAGCACGAGAAAGAAGTGCTTCTCGAGAAGCACTTCTTTCTCGTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281293    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_005563.3-1368s21c1
Sequence:CCGGGCGTGTTTCTAGAGAACAGTTCTCGAGAACTGTTCTCTAGAAACACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281370    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_005563.3-545s21c1
Sequence:CCGGGCGAGAGAAGGATAAGCACATCTCGAGATGTGCTTATCCTTCTCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019641
VALIDATED
STMN1 MISSION shRNA Bacterial Glycerol Stock
stathmin 1
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000071623    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019641.2-565s1c1
Sequence:CCGGCCTAAATATCCAAAGACTGTACTCGAGTACAGTCTTTGGATATTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019641.2-479s1c1
Sequence:CCGGCGGAAGAACAAAGAATCCAAACTCGAGTTTGGATTCTTTGTTCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019641.2-331s1c1
Sequence:CCGGGAAAGCCATCGAGGAGAACAACTCGAGTTGTTCTCCTCGATGGCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071627    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019641.2-217s1c1
Sequence:CCGGCCTGGAGGAAATCCAGAAGAACTCGAGTTCTTCTGGATTTCCTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071625    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019641.2-248s1c1
Sequence:CCGGGCAGAAGAAAGACGCAAGTCTCTCGAGAGACTTGCGTCTTTCTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374652    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019641.3-453s21c1
Sequence:CCGGAGAAGGACAAGCACGTGGAAGCTCGAGCTTCCACGTGCTTGTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312845    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019641.3-145s21c1
Sequence:CCGGGATTCTCAGCCCTCGGTCAAACTCGAGTTTGACCGAGGGCTGAGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312803    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019641.3-629s21c1
Sequence:CCGGAGCCGATGTAGGACCGTATAGCTCGAGCTATACGGTCCTACATCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019641.3-331s21c1
Sequence:CCGGGAAAGCCATCGAGGAGAACAACTCGAGTTGTTCTCCTCGATGGCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311863    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019641.3-248s21c1
Sequence:CCGGGCAGAAGAAAGACGCAAGTCTCTCGAGAGACTTGCGTCTTTCTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374584    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019641.3-775s21c1
Sequence:CCGGCAATCGGTGTGCTGGGTTAATCTCGAGATTAACCCAGCACACCGATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019641
VALIDATED
STMN1 MISSION shRNA shRNA Plasmid DNA
stathmin 1
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000071623    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019641.2-565s1c1
Sequence:CCGGCCTAAATATCCAAAGACTGTACTCGAGTACAGTCTTTGGATATTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019641.2-479s1c1
Sequence:CCGGCGGAAGAACAAAGAATCCAAACTCGAGTTTGGATTCTTTGTTCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019641.2-331s1c1
Sequence:CCGGGAAAGCCATCGAGGAGAACAACTCGAGTTGTTCTCCTCGATGGCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071627    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019641.2-217s1c1
Sequence:CCGGCCTGGAGGAAATCCAGAAGAACTCGAGTTCTTCTGGATTTCCTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071625    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019641.2-248s1c1
Sequence:CCGGGCAGAAGAAAGACGCAAGTCTCTCGAGAGACTTGCGTCTTTCTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374652    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019641.3-453s21c1
Sequence:CCGGAGAAGGACAAGCACGTGGAAGCTCGAGCTTCCACGTGCTTGTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312845    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019641.3-145s21c1
Sequence:CCGGGATTCTCAGCCCTCGGTCAAACTCGAGTTTGACCGAGGGCTGAGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312803    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019641.3-629s21c1
Sequence:CCGGAGCCGATGTAGGACCGTATAGCTCGAGCTATACGGTCCTACATCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019641.3-331s21c1
Sequence:CCGGGAAAGCCATCGAGGAGAACAACTCGAGTTGTTCTCCTCGATGGCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311863    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019641.3-248s21c1
Sequence:CCGGGCAGAAGAAAGACGCAAGTCTCTCGAGAGACTTGCGTCTTTCTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374584    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019641.3-775s21c1
Sequence:CCGGCAATCGGTGTGCTGGGTTAATCTCGAGATTAACCCAGCACACCGATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019641
VALIDATED
STMN1 MISSION shRNA Lentiviral Transduction Particles
stathmin 1
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000071623    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019641.2-565s1c1
Sequence:CCGGCCTAAATATCCAAAGACTGTACTCGAGTACAGTCTTTGGATATTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019641.2-479s1c1
Sequence:CCGGCGGAAGAACAAAGAATCCAAACTCGAGTTTGGATTCTTTGTTCTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019641.2-331s1c1
Sequence:CCGGGAAAGCCATCGAGGAGAACAACTCGAGTTGTTCTCCTCGATGGCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071627    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019641.2-217s1c1
Sequence:CCGGCCTGGAGGAAATCCAGAAGAACTCGAGTTCTTCTGGATTTCCTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071625    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019641.2-248s1c1
Sequence:CCGGGCAGAAGAAAGACGCAAGTCTCTCGAGAGACTTGCGTCTTTCTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374652    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019641.3-453s21c1
Sequence:CCGGAGAAGGACAAGCACGTGGAAGCTCGAGCTTCCACGTGCTTGTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312845    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019641.3-145s21c1
Sequence:CCGGGATTCTCAGCCCTCGGTCAAACTCGAGTTTGACCGAGGGCTGAGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312803    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019641.3-629s21c1
Sequence:CCGGAGCCGATGTAGGACCGTATAGCTCGAGCTATACGGTCCTACATCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019641.3-331s21c1
Sequence:CCGGGAAAGCCATCGAGGAGAACAACTCGAGTTGTTCTCCTCGATGGCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311863    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019641.3-248s21c1
Sequence:CCGGGCAGAAGAAAGACGCAAGTCTCTCGAGAGACTTGCGTCTTTCTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374584    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019641.3-775s21c1
Sequence:CCGGCAATCGGTGTGCTGGGTTAATCTCGAGATTAACCCAGCACACCGATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks