EMAIL THIS PAGE TO A FRIEND

STMN2

stathmin-like 2

Synonyms: SCG10 SCGN10
UniProtKB ID: Q93045, A8K9M2, G3V110, O14952, Q6PK68
Gene ID:
Human(11075) Summary: This gene encodes a member of the stathmin family of phosphoproteins. Stathmin proteins function in microtubule dynamics and signal transduction. The encoded protein plays a regulatory role in neuronal growth and is also thought to be involved in osteogenesis. Reductions in the expression of this gene have been associated with Down's syndrome and Alzheimer's disease. Alternatively spliced transcript variants have been observed for this gene. A pseudogene of this gene is located on the long arm of chromosome 6. [provided by RefSeq, Nov 2010]
Mouse(20257) stathmin-like 2
Rat(84510) stathmin-like 2
chicken(396095) stathmin-like 2
dog(477918) stathmin-like 2
domestic cat(101085180) stathmin-like 2
cow(534991) stathmin-like 2
sheep(101111294) stathmin-like 2
naked mole-rat(101712815) stathmin-like 2
52 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025285 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025285 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025285 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_007029 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007029 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007029 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007029 Rosetta Predictions human pricing
NM_053440 Rosetta Predictions rat pricing
NM_025285 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007029 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00042412 predicted 363
2 SASI_Hs01_00042413 predicted 382
3 SASI_Hs01_00042414 predicted 379
4 SASI_Hs01_00042415 predicted 371
5 SASI_Hs01_00042416 predicted 213
6 SASI_Hs01_00042417 predicted 227
7 SASI_Hs01_00042418 predicted 352
8 SASI_Hs01_00042419 predicted 256
9 SASI_Hs02_00342802 predicted 375
10 SASI_Hs02_00342803 predicted 316
11 SASI_Hs01_00042420 predicted 357
12 SASI_Hs01_00042421 predicted 227
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053440 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00056703 predicted 384
2 SASI_Rn01_00056704 predicted 970
3 SASI_Rn01_00056705 predicted 403
4 SASI_Rn01_00056706 predicted 460
5 SASI_Rn01_00056707 predicted 808
6 SASI_Rn01_00056708 predicted 533
7 SASI_Rn01_00056709 predicted 813
8 SASI_Rn01_00056710 predicted 179
9 SASI_Rn01_00056711 predicted 876
10 SASI_Rn01_00056712 predicted 631
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025285 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00327901 predicted 980
2 SASI_Mm01_00160752 predicted 1094
3 SASI_Mm01_00160753 predicted 1028
4 SASI_Mm01_00160754 predicted 488
5 SASI_Mm01_00160755 predicted 1027
6 SASI_Mm01_00160756 predicted 274
7 SASI_Mm01_00160757 predicted 1113
8 SASI_Mm01_00160758 predicted 1062
9 SASI_Mm01_00160760 predicted 1109
10 SASI_Mm01_00160761 predicted 255
11 SASI_Mm01_00160759 predicted 319
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025285
STMN2 MISSION shRNA Bacterial Glycerol Stock
stathmin-like 2
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000443793    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025285.2-1071s21c1
Sequence:CCGGGACCTAGATGACTCCGTAATCCTCGAGGATTACGGAGTCATCTAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414125    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025285.2-684s21c1
Sequence:CCGGGGATCATGCGATATCAGTATGCTCGAGCATACTGATATCGCATGATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434244    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025285.2-706s21c1
Sequence:CCGGGAAGTGTATGACATGGTTTAACTCGAGTTAAACCATGTCATACACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175947    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025285.1-527s1c1
Sequence:CCGGGCTAATCTAGCTGCTATCATTCTCGAGAATGATAGCAGCTAGATTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175204    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025285.1-175s1c1
Sequence:CCGGCAATATCAACATCTACACCTACTCGAGTAGGTGTAGATGTTGATATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175361    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025285.1-1508s1c1
Sequence:CCGGCCTGTAGTACAAGCACATAATCTCGAGATTATGTGCTTGTACTACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173677    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025285.1-305s1c1
Sequence:CCGGCCAAAGAAGAAAGACCTGTCTCTCGAGAGACAGGTCTTTCTTCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025285
STMN2 MISSION shRNA shRNA Plasmid DNA
stathmin-like 2
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000443793    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025285.2-1071s21c1
Sequence:CCGGGACCTAGATGACTCCGTAATCCTCGAGGATTACGGAGTCATCTAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414125    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025285.2-684s21c1
Sequence:CCGGGGATCATGCGATATCAGTATGCTCGAGCATACTGATATCGCATGATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434244    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025285.2-706s21c1
Sequence:CCGGGAAGTGTATGACATGGTTTAACTCGAGTTAAACCATGTCATACACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175947    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025285.1-527s1c1
Sequence:CCGGGCTAATCTAGCTGCTATCATTCTCGAGAATGATAGCAGCTAGATTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175204    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025285.1-175s1c1
Sequence:CCGGCAATATCAACATCTACACCTACTCGAGTAGGTGTAGATGTTGATATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175361    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025285.1-1508s1c1
Sequence:CCGGCCTGTAGTACAAGCACATAATCTCGAGATTATGTGCTTGTACTACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173677    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025285.1-305s1c1
Sequence:CCGGCCAAAGAAGAAAGACCTGTCTCTCGAGAGACAGGTCTTTCTTCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025285
STMN2 MISSION shRNA Lentiviral Transduction Particles
stathmin-like 2
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000443793    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025285.2-1071s21c1
Sequence:CCGGGACCTAGATGACTCCGTAATCCTCGAGGATTACGGAGTCATCTAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414125    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025285.2-684s21c1
Sequence:CCGGGGATCATGCGATATCAGTATGCTCGAGCATACTGATATCGCATGATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434244    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025285.2-706s21c1
Sequence:CCGGGAAGTGTATGACATGGTTTAACTCGAGTTAAACCATGTCATACACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175947    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025285.1-527s1c1
Sequence:CCGGGCTAATCTAGCTGCTATCATTCTCGAGAATGATAGCAGCTAGATTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175204    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025285.1-175s1c1
Sequence:CCGGCAATATCAACATCTACACCTACTCGAGTAGGTGTAGATGTTGATATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175361    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025285.1-1508s1c1
Sequence:CCGGCCTGTAGTACAAGCACATAATCTCGAGATTATGTGCTTGTACTACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173677    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025285.1-305s1c1
Sequence:CCGGCCAAAGAAGAAAGACCTGTCTCTCGAGAGACAGGTCTTTCTTCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007029
STMN2 MISSION shRNA Bacterial Glycerol Stock
stathmin-like 2
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000144793    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007029.2-420s1c1
Sequence:CCGGGAACAACAACTTCAGCAAGATCTCGAGATCTTGCTGAAGTTGTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144455    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007029.2-499s1c1
Sequence:CCGGCTAGCTGCTATTATTGAACGTCTCGAGACGTTCAATAATAGCAGCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142330    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007029.2-254s1c1
Sequence:CCGGCACGAACTTTAGCTTCTCCAACTCGAGTTGGAGAAGCTAAAGTTCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007029.2-181s1c1
Sequence:CCGGCAAATCAACAAACGTGCCTCTCTCGAGAGAGGCACGTTTGTTGATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007029.2-105s1c1
Sequence:CCGGGTCACTGATCTGCTCTTGCTTCTCGAGAAGCAAGAGCAGATCAGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139570    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007029.2-364s1c1
Sequence:CCGGCAATTGGCAGAGAAGAGGGAACTCGAGTTCCCTCTTCTCTGCCAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007029.2-565s1c1
Sequence:CCGGGAACTCCAGGTTGAACTGTCTCTCGAGAGACAGTTCAACCTGGAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007029.2-488s1c1
Sequence:CCGGGTGAGGCTAATCTAGCTGCTACTCGAGTAGCAGCTAGATTAGCCTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141738    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007029.2-490s1c1
Sequence:CCGGGAGGCTAATCTAGCTGCTATTCTCGAGAATAGCAGCTAGATTAGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142280    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007029.2-322s1c1
Sequence:CCGGGCAGAGGAAAGAAGAAAGTCTCTCGAGAGACTTTCTTCTTTCCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007029.2-357s1c1
Sequence:CCGGGCTGAAACAATTGGCAGAGAACTCGAGTTCTCTGCCAATTGTTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007029
STMN2 MISSION shRNA shRNA Plasmid DNA
stathmin-like 2
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000144793    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007029.2-420s1c1
Sequence:CCGGGAACAACAACTTCAGCAAGATCTCGAGATCTTGCTGAAGTTGTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144455    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007029.2-499s1c1
Sequence:CCGGCTAGCTGCTATTATTGAACGTCTCGAGACGTTCAATAATAGCAGCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142330    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007029.2-254s1c1
Sequence:CCGGCACGAACTTTAGCTTCTCCAACTCGAGTTGGAGAAGCTAAAGTTCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007029.2-181s1c1
Sequence:CCGGCAAATCAACAAACGTGCCTCTCTCGAGAGAGGCACGTTTGTTGATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007029.2-105s1c1
Sequence:CCGGGTCACTGATCTGCTCTTGCTTCTCGAGAAGCAAGAGCAGATCAGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139570    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007029.2-364s1c1
Sequence:CCGGCAATTGGCAGAGAAGAGGGAACTCGAGTTCCCTCTTCTCTGCCAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007029.2-565s1c1
Sequence:CCGGGAACTCCAGGTTGAACTGTCTCTCGAGAGACAGTTCAACCTGGAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007029.2-488s1c1
Sequence:CCGGGTGAGGCTAATCTAGCTGCTACTCGAGTAGCAGCTAGATTAGCCTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141738    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007029.2-490s1c1
Sequence:CCGGGAGGCTAATCTAGCTGCTATTCTCGAGAATAGCAGCTAGATTAGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142280    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007029.2-322s1c1
Sequence:CCGGGCAGAGGAAAGAAGAAAGTCTCTCGAGAGACTTTCTTCTTTCCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007029.2-357s1c1
Sequence:CCGGGCTGAAACAATTGGCAGAGAACTCGAGTTCTCTGCCAATTGTTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007029
STMN2 MISSION shRNA Lentiviral Transduction Particles
stathmin-like 2
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000144793    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007029.2-420s1c1
Sequence:CCGGGAACAACAACTTCAGCAAGATCTCGAGATCTTGCTGAAGTTGTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144455    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007029.2-499s1c1
Sequence:CCGGCTAGCTGCTATTATTGAACGTCTCGAGACGTTCAATAATAGCAGCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142330    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007029.2-254s1c1
Sequence:CCGGCACGAACTTTAGCTTCTCCAACTCGAGTTGGAGAAGCTAAAGTTCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007029.2-181s1c1
Sequence:CCGGCAAATCAACAAACGTGCCTCTCTCGAGAGAGGCACGTTTGTTGATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140630    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007029.2-105s1c1
Sequence:CCGGGTCACTGATCTGCTCTTGCTTCTCGAGAAGCAAGAGCAGATCAGTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139570    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007029.2-364s1c1
Sequence:CCGGCAATTGGCAGAGAAGAGGGAACTCGAGTTCCCTCTTCTCTGCCAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140472    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007029.2-565s1c1
Sequence:CCGGGAACTCCAGGTTGAACTGTCTCTCGAGAGACAGTTCAACCTGGAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140826    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007029.2-488s1c1
Sequence:CCGGGTGAGGCTAATCTAGCTGCTACTCGAGTAGCAGCTAGATTAGCCTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141738    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007029.2-490s1c1
Sequence:CCGGGAGGCTAATCTAGCTGCTATTCTCGAGAATAGCAGCTAGATTAGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142280    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007029.2-322s1c1
Sequence:CCGGGCAGAGGAAAGAAGAAAGTCTCTCGAGAGACTTTCTTCTTTCCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007029.2-357s1c1
Sequence:CCGGGCTGAAACAATTGGCAGAGAACTCGAGTTCTCTGCCAATTGTTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks