EMAIL THIS PAGE TO A FRIEND

STMN3

stathmin-like 3

Synonyms: SCLIP
UniProtKB ID: Q9NZ72, B3KSQ5, B7WP52, O75527, Q969Y4
Gene ID:
Human(50861) Summary: This gene encodes a protein which is a member of the stathmin protein family. Members of this protein family form a complex with tubulins at a ratio of 2 tubulins for each stathmin protein. Microtubules require the ordered assembly of alpha- and beta-tubulins, and formation of a complex with stathmin disrupts microtubule formation and function. A pseudogene of this gene is located on chromosome 22. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2013]
Mouse(20262) stathmin-like 3
Rat(29246) stathmin-like 3
chicken(419263) stathmin-like 3
domestic cat(101099286) stathmin-like 3
dog(477288) stathmin-like 3
naked mole-rat(101724612) stathmin-like 3
cow(511110) stathmin-like 3
sheep(101108850) stathmin-like 3
46 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009133 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009133 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009133 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015894 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015894 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015894 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU127181 MISSION® esiRNA esiRNA human STMN3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015894 Rosetta Predictions human pricing
NM_024346 Rosetta Predictions rat pricing
NM_009133 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015894 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00199414 predicted 434
2 SASI_Hs01_00199415 predicted 938
3 SASI_Hs02_00348482 predicted 962
4 SASI_Hs01_00199416 predicted 1024
5 SASI_Hs01_00199417 predicted 1112
6 SASI_Hs01_00199418 predicted 85
7 SASI_Hs01_00199419 predicted 603
8 SASI_Hs01_00199420 predicted 135
9 SASI_Hs02_00348483 predicted 1429
10 SASI_Hs02_00348484 predicted 1430
11 SASI_Hs01_00199421 predicted 1572
12 SASI_Hs01_00199422 predicted 2182
13 SASI_Hs01_00199423 predicted 2183
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024346 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00103170 predicted 766
2 SASI_Rn01_00103171 predicted 310
3 SASI_Rn01_00103172 predicted 268
4 SASI_Rn01_00103173 predicted 302
5 SASI_Rn02_00263900 predicted 724
6 SASI_Rn01_00103175 predicted 737
7 SASI_Rn01_00103176 predicted 613
8 SASI_Rn01_00103177 predicted 228
9 SASI_Rn01_00103178 predicted 738
10 SASI_Rn01_00103179 predicted 256
11 SASI_Rn01_00103174 predicted 749
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009133 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00071961 predicted 371
2 SASI_Mm01_00071962 predicted 385
3 SASI_Mm01_00071963 predicted 374
4 SASI_Mm01_00071964 predicted 680
5 SASI_Mm01_00071965 predicted 391
6 SASI_Mm01_00071966 predicted 803
7 SASI_Mm01_00071967 predicted 440
8 SASI_Mm01_00071968 predicted 509
9 SASI_Mm01_00071969 predicted 455
10 SASI_Mm01_00071970 predicted 378
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009133
STMN3 MISSION shRNA Bacterial Glycerol Stock
stathmin-like 3
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000183015    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_009133.2-886s1c1
Sequence:CCGGCAATTCTGTCTAGATGCGAATCTCGAGATTCGCATCTAGACAGAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196155    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009133.2-346s1c1
Sequence:CCGGGCTCATTTGCTCCTGCTTCTACTCGAGTAGAAGCAGGAGCAAATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184270    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009133.2-694s1c1
Sequence:CCGGGCTCAACTACAAGATGGAGCTCTCGAGAGCTCCATCTTGTAGTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009133.3-820s21c1
Sequence:CCGGATGTCTGGCTAAGGAGTATTGCTCGAGCAATACTCCTTAGCCAGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250680    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009133.3-887s21c1
Sequence:CCGGATTCTGTCTAGATGCGAATTTCTCGAGAAATTCGCATCTAGACAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250682    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009133.3-332s21c1
Sequence:CCGGTATCTGTGCTGTCGCTCATTTCTCGAGAAATGAGCGACAGCACAGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216619    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009133.3-316s1c1
Sequence:CCGGGAGAAGATGAAGGAGTTATCTCTCGAGAGATAACTCCTTCATCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009133.3-380s21c1
Sequence:CCGGCGAACACCATCTACCAGTATGCTCGAGCATACTGGTAGATGGTGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009133.3-408s21c1
Sequence:CCGGGGAAGTGAAGCAGCTGGATAACTCGAGTTATCCAGCTGCTTCACTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009133
STMN3 MISSION shRNA shRNA Plasmid DNA
stathmin-like 3
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000183015    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_009133.2-886s1c1
Sequence:CCGGCAATTCTGTCTAGATGCGAATCTCGAGATTCGCATCTAGACAGAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196155    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009133.2-346s1c1
Sequence:CCGGGCTCATTTGCTCCTGCTTCTACTCGAGTAGAAGCAGGAGCAAATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184270    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009133.2-694s1c1
Sequence:CCGGGCTCAACTACAAGATGGAGCTCTCGAGAGCTCCATCTTGTAGTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009133.3-820s21c1
Sequence:CCGGATGTCTGGCTAAGGAGTATTGCTCGAGCAATACTCCTTAGCCAGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250680    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009133.3-887s21c1
Sequence:CCGGATTCTGTCTAGATGCGAATTTCTCGAGAAATTCGCATCTAGACAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250682    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009133.3-332s21c1
Sequence:CCGGTATCTGTGCTGTCGCTCATTTCTCGAGAAATGAGCGACAGCACAGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216619    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009133.3-316s1c1
Sequence:CCGGGAGAAGATGAAGGAGTTATCTCTCGAGAGATAACTCCTTCATCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009133.3-380s21c1
Sequence:CCGGCGAACACCATCTACCAGTATGCTCGAGCATACTGGTAGATGGTGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009133.3-408s21c1
Sequence:CCGGGGAAGTGAAGCAGCTGGATAACTCGAGTTATCCAGCTGCTTCACTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009133
STMN3 MISSION shRNA Lentiviral Transduction Particles
stathmin-like 3
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000183015    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_009133.2-886s1c1
Sequence:CCGGCAATTCTGTCTAGATGCGAATCTCGAGATTCGCATCTAGACAGAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196155    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009133.2-346s1c1
Sequence:CCGGGCTCATTTGCTCCTGCTTCTACTCGAGTAGAAGCAGGAGCAAATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184270    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009133.2-694s1c1
Sequence:CCGGGCTCAACTACAAGATGGAGCTCTCGAGAGCTCCATCTTGTAGTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250681    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009133.3-820s21c1
Sequence:CCGGATGTCTGGCTAAGGAGTATTGCTCGAGCAATACTCCTTAGCCAGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250680    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009133.3-887s21c1
Sequence:CCGGATTCTGTCTAGATGCGAATTTCTCGAGAAATTCGCATCTAGACAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250682    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009133.3-332s21c1
Sequence:CCGGTATCTGTGCTGTCGCTCATTTCTCGAGAAATGAGCGACAGCACAGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216619    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009133.3-316s1c1
Sequence:CCGGGAGAAGATGAAGGAGTTATCTCTCGAGAGATAACTCCTTCATCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250684    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009133.3-380s21c1
Sequence:CCGGCGAACACCATCTACCAGTATGCTCGAGCATACTGGTAGATGGTGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009133.3-408s21c1
Sequence:CCGGGGAAGTGAAGCAGCTGGATAACTCGAGTTATCCAGCTGCTTCACTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015894
STMN3 MISSION shRNA Bacterial Glycerol Stock
stathmin-like 3
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000063853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015894.2-604s1c1
Sequence:CCGGGCGAGAAGAGATGTCGGGCTACTCGAGTAGCCCGACATCTCTTCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015894.2-321s1c1
Sequence:CCGGCCTCCCTGGAGGAGCTGCAAACTCGAGTTTGCAGCTCCTCCAGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000063856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015894.2-444s1c1
Sequence:CCGGCGCTGGAGGAGAATAACAACTCTCGAGAGTTGTTATTCTCCTCCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000447448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015894.2-173s21c1
Sequence:CCGGCCCAATACCGTCTACCAGTACCTCGAGGTACTGGTAGACGGTATTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418081    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015894.2-692s21c1
Sequence:CCGGCCTCTGTCTAGATGCAACTTTCTCGAGAAAGTTGCATCTAGACAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438396    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015894.2-654s21c1
Sequence:CCGGCGACAGAACACGTTCGGGTTTCTCGAGAAACCCGAACGTGTTCTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015894
STMN3 MISSION shRNA shRNA Plasmid DNA
stathmin-like 3
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000063853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015894.2-604s1c1
Sequence:CCGGGCGAGAAGAGATGTCGGGCTACTCGAGTAGCCCGACATCTCTTCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015894.2-321s1c1
Sequence:CCGGCCTCCCTGGAGGAGCTGCAAACTCGAGTTTGCAGCTCCTCCAGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000063856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015894.2-444s1c1
Sequence:CCGGCGCTGGAGGAGAATAACAACTCTCGAGAGTTGTTATTCTCCTCCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000447448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015894.2-173s21c1
Sequence:CCGGCCCAATACCGTCTACCAGTACCTCGAGGTACTGGTAGACGGTATTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418081    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015894.2-692s21c1
Sequence:CCGGCCTCTGTCTAGATGCAACTTTCTCGAGAAAGTTGCATCTAGACAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438396    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015894.2-654s21c1
Sequence:CCGGCGACAGAACACGTTCGGGTTTCTCGAGAAACCCGAACGTGTTCTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015894
STMN3 MISSION shRNA Lentiviral Transduction Particles
stathmin-like 3
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000063853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015894.2-604s1c1
Sequence:CCGGGCGAGAAGAGATGTCGGGCTACTCGAGTAGCCCGACATCTCTTCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015894.2-321s1c1
Sequence:CCGGCCTCCCTGGAGGAGCTGCAAACTCGAGTTTGCAGCTCCTCCAGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000063856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015894.2-444s1c1
Sequence:CCGGCGCTGGAGGAGAATAACAACTCTCGAGAGTTGTTATTCTCCTCCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000447448    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015894.2-173s21c1
Sequence:CCGGCCCAATACCGTCTACCAGTACCTCGAGGTACTGGTAGACGGTATTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418081    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015894.2-692s21c1
Sequence:CCGGCCTCTGTCTAGATGCAACTTTCTCGAGAAAGTTGCATCTAGACAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438396    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015894.2-654s21c1
Sequence:CCGGCGACAGAACACGTTCGGGTTTCTCGAGAAACCCGAACGTGTTCTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks