EMAIL THIS PAGE TO A FRIEND

STMN4

stathmin-like 4

Synonyms: RB3
UniProtKB ID: Q9H169, D3DSS8, D3DSS9, Q2TAB9
Gene ID:
Mouse(56471) stathmin-like 4
Rat(79423) stathmin-like 4
cow(512732) stathmin-like 4
sheep(101108107) stathmin-like 4
naked mole-rat(101712846) stathmin-like 4
Zebrafish(406710) stathmin-like 4
domestic cat(101090857) stathmin-like 4
dog(486105) stathmin-like 4
chicken(422010) stathmin-like 4
107 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030795 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_030795 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_030795 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019675 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019675 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019675 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_030795 Rosetta Predictions human pricing
XM_001067575 Rosetta Predictions rat pricing
XM_001067632 Rosetta Predictions rat pricing
XM_001074337 Rosetta Predictions rat pricing
XM_341341 Rosetta Predictions rat pricing
NM_019675 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030795 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00072839 predicted 242
2 SASI_Hs01_00072840 predicted 374
3 SASI_Hs01_00072841 predicted 624
4 SASI_Hs02_00358349 predicted 303
5 SASI_Hs02_00358350 predicted 325
6 SASI_Hs01_00072842 predicted 255
7 SASI_Hs01_00072843 predicted 309
8 SASI_Hs02_00358351 predicted 309
9 SASI_Hs02_00358352 predicted 546
10 SASI_Hs02_00358353 predicted 317
11 SASI_Hs01_00072835 predicted 492
12 SASI_Hs01_00072836 predicted 344
13 SASI_Hs01_00072837 predicted 548
14 SASI_Hs01_00072838 predicted 552
15 SASI_Hs01_00072844 predicted 534
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001067575 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00321434 predicted 415
2 SASI_Rn02_00321435 predicted 699
3 SASI_Rn02_00321436 predicted 384
4 SASI_Rn02_00321437 predicted 206
5 SASI_Rn02_00321438 predicted 525
6 SASI_Rn02_00321439 predicted 616
7 SASI_Rn02_00321440 predicted 263
8 SASI_Rn02_00321441 predicted 369
9 SASI_Rn02_00321442 predicted 220
10 SASI_Rn02_00321443 predicted 227
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001067632 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00321636 predicted 400
2 SASI_Rn02_00321637 predicted 277
3 SASI_Rn02_00321638 predicted 604
4 SASI_Rn02_00321639 predicted 338
5 SASI_Rn02_00321640 predicted 631
6 SASI_Rn02_00321641 predicted 352
7 SASI_Rn02_00321642 predicted 290
8 SASI_Rn02_00321643 predicted 300
9 SASI_Rn02_00321644 predicted 340
10 SASI_Rn02_00321645 predicted 328
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001074337 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00345844 predicted 396
2 SASI_Rn02_00345845 predicted 372
3 SASI_Rn02_00345846 predicted 512
4 SASI_Rn02_00345847 predicted 355
5 SASI_Rn02_00345848 predicted 358
6 SASI_Rn02_00345849 predicted 374
7 SASI_Rn02_00345850 predicted 361
8 SASI_Rn02_00345851 predicted 428
9 SASI_Rn02_00345852 predicted 423
10 SASI_Rn02_00345853 predicted 382
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_341341 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00392768 predicted 626
2 SASI_Rn02_00392769 predicted 624
3 SASI_Rn02_00392770 predicted 618
4 SASI_Rn02_00392771 predicted 642
5 SASI_Rn02_00392772 predicted 622
6 SASI_Rn02_00392773 predicted 624
7 SASI_Rn02_00392774 predicted 584
8 SASI_Rn02_00392775 predicted 622
9 SASI_Rn02_00392776 predicted 618
10 SASI_Rn02_00392777 predicted 606
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019675 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00098978 predicted 231
2 SASI_Mm01_00098979 predicted 223
3 SASI_Mm02_00324752 predicted 546
4 SASI_Mm01_00098980 predicted 548
5 SASI_Mm01_00098981 predicted 485
6 SASI_Mm01_00098982 predicted 424
7 SASI_Mm01_00098983 predicted 216
8 SASI_Mm01_00098984 predicted 378
9 SASI_Mm01_00098985 predicted 370
10 SASI_Mm01_00098986 predicted 375
11 SASI_Mm01_00098987 predicted 266
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030795
STMN4 MISSION shRNA Bacterial Glycerol Stock
stathmin-like 4
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000164435    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030795.2-632s1c1
Sequence:CCGGCCCAGAAGATGGAATCCAACACTCGAGTGTTGGATTCCATCTTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164407    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030795.2-541s1c1
Sequence:CCGGCTAGCAGAGAAACGGGAACATCTCGAGATGTTCCCGTTTCTCTGCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163424    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_030795.2-985s1c1
Sequence:CCGGGAGAGGAGAGAGTTTGGGAAACTCGAGTTTCCCAAACTCTCTCCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163346    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_030795.2-775s1c1
Sequence:CCGGGCCAAAGAACTTTCCAGGTCACTCGAGTGACCTGGAAAGTTCTTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163179    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_030795.2-930s1c1
Sequence:CCGGGACCAGTGAAGCCATCCTATTCTCGAGAATAGGATGGCTTCACTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160167    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030795.2-600s1c1
Sequence:CCGGCAACTTCATCAAGATGGCTAACTCGAGTTAGCCATCTTGATGAAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160451    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030795.2-196s1c1
Sequence:CCGGCTGAATAAGTCGTCCTACAAACTCGAGTTTGTAGGACGACTTATTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160910    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030795.2-346s1c1
Sequence:CCGGGAAGTCATCGAGCTGAACAAACTCGAGTTTGTTCAGCTCGATGACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162193    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030795.2-209s1c1
Sequence:CCGGCCTACAAATATGAAGGCTGGTCTCGAGACCAGCCTTCATATTTGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162711    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030795.2-333s1c1
Sequence:CCGGCATTTCCGACATGGAAGTCATCTCGAGATGACTTCCATGTCGGAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030795
STMN4 MISSION shRNA shRNA Plasmid DNA
stathmin-like 4
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000164435    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030795.2-632s1c1
Sequence:CCGGCCCAGAAGATGGAATCCAACACTCGAGTGTTGGATTCCATCTTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164407    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030795.2-541s1c1
Sequence:CCGGCTAGCAGAGAAACGGGAACATCTCGAGATGTTCCCGTTTCTCTGCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163424    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_030795.2-985s1c1
Sequence:CCGGGAGAGGAGAGAGTTTGGGAAACTCGAGTTTCCCAAACTCTCTCCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163346    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_030795.2-775s1c1
Sequence:CCGGGCCAAAGAACTTTCCAGGTCACTCGAGTGACCTGGAAAGTTCTTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163179    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_030795.2-930s1c1
Sequence:CCGGGACCAGTGAAGCCATCCTATTCTCGAGAATAGGATGGCTTCACTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160167    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030795.2-600s1c1
Sequence:CCGGCAACTTCATCAAGATGGCTAACTCGAGTTAGCCATCTTGATGAAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160451    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030795.2-196s1c1
Sequence:CCGGCTGAATAAGTCGTCCTACAAACTCGAGTTTGTAGGACGACTTATTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160910    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030795.2-346s1c1
Sequence:CCGGGAAGTCATCGAGCTGAACAAACTCGAGTTTGTTCAGCTCGATGACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162193    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030795.2-209s1c1
Sequence:CCGGCCTACAAATATGAAGGCTGGTCTCGAGACCAGCCTTCATATTTGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162711    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030795.2-333s1c1
Sequence:CCGGCATTTCCGACATGGAAGTCATCTCGAGATGACTTCCATGTCGGAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030795
STMN4 MISSION shRNA Lentiviral Transduction Particles
stathmin-like 4
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000164435    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030795.2-632s1c1
Sequence:CCGGCCCAGAAGATGGAATCCAACACTCGAGTGTTGGATTCCATCTTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164407    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030795.2-541s1c1
Sequence:CCGGCTAGCAGAGAAACGGGAACATCTCGAGATGTTCCCGTTTCTCTGCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163424    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_030795.2-985s1c1
Sequence:CCGGGAGAGGAGAGAGTTTGGGAAACTCGAGTTTCCCAAACTCTCTCCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163346    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_030795.2-775s1c1
Sequence:CCGGGCCAAAGAACTTTCCAGGTCACTCGAGTGACCTGGAAAGTTCTTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163179    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_030795.2-930s1c1
Sequence:CCGGGACCAGTGAAGCCATCCTATTCTCGAGAATAGGATGGCTTCACTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160167    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030795.2-600s1c1
Sequence:CCGGCAACTTCATCAAGATGGCTAACTCGAGTTAGCCATCTTGATGAAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160451    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030795.2-196s1c1
Sequence:CCGGCTGAATAAGTCGTCCTACAAACTCGAGTTTGTAGGACGACTTATTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160910    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030795.2-346s1c1
Sequence:CCGGGAAGTCATCGAGCTGAACAAACTCGAGTTTGTTCAGCTCGATGACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162193    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030795.2-209s1c1
Sequence:CCGGCCTACAAATATGAAGGCTGGTCTCGAGACCAGCCTTCATATTTGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162711    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030795.2-333s1c1
Sequence:CCGGCATTTCCGACATGGAAGTCATCTCGAGATGACTTCCATGTCGGAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019675
STMN4 MISSION shRNA Bacterial Glycerol Stock
stathmin-like 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000115529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019675.2-380s1c1
Sequence:CCGGCCCATCATTAGAAGAGATTCACTCGAGTGAATCTCTTCTAATGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019675.2-378s1c1
Sequence:CCGGGACCCATCATTAGAAGAGATTCTCGAGAATCTCTTCTAATGATGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019675.2-197s1c1
Sequence:CCGGCCTGAATAAATCATCCTACAACTCGAGTTGTAGGATGATTTATTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115526    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019675.2-1035s1c1
Sequence:CCGGCGAGTGGAGAGAAGATGAGAACTCGAGTTCTCATCTTCTCTCCACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019675.2-254s1c1
Sequence:CCGGCATCTCTGATATGGAAGTCATCTCGAGATGACTTCCATATCAGAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019675
STMN4 MISSION shRNA shRNA Plasmid DNA
stathmin-like 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000115529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019675.2-380s1c1
Sequence:CCGGCCCATCATTAGAAGAGATTCACTCGAGTGAATCTCTTCTAATGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019675.2-378s1c1
Sequence:CCGGGACCCATCATTAGAAGAGATTCTCGAGAATCTCTTCTAATGATGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019675.2-197s1c1
Sequence:CCGGCCTGAATAAATCATCCTACAACTCGAGTTGTAGGATGATTTATTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115526    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019675.2-1035s1c1
Sequence:CCGGCGAGTGGAGAGAAGATGAGAACTCGAGTTCTCATCTTCTCTCCACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019675.2-254s1c1
Sequence:CCGGCATCTCTGATATGGAAGTCATCTCGAGATGACTTCCATATCAGAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019675
STMN4 MISSION shRNA Lentiviral Transduction Particles
stathmin-like 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000115529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019675.2-380s1c1
Sequence:CCGGCCCATCATTAGAAGAGATTCACTCGAGTGAATCTCTTCTAATGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115528    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019675.2-378s1c1
Sequence:CCGGGACCCATCATTAGAAGAGATTCTCGAGAATCTCTTCTAATGATGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019675.2-197s1c1
Sequence:CCGGCCTGAATAAATCATCCTACAACTCGAGTTGTAGGATGATTTATTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115526    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019675.2-1035s1c1
Sequence:CCGGCGAGTGGAGAGAAGATGAGAACTCGAGTTCTCATCTTCTCTCCACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115530    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019675.2-254s1c1
Sequence:CCGGCATCTCTGATATGGAAGTCATCTCGAGATGACTTCCATATCAGAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks