EMAIL THIS PAGE TO A FRIEND

STMND1

stathmin domain containing 1

UniProtKB ID: H3BQB6
Gene ID:
Mouse(380842) stathmin domain containing 1
Rat(498719) stathmin domain containing 1
chicken(101664825) stathmin domain containing 1
chicken(101747319) stathmin domain containing 1
domestic guinea pig(100720144) stathmin domain containing 1
naked mole-rat(101709489) stathmin domain containing 1
cow(100848740) stathmin domain containing 1
73 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA067970 Anti-STMND1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001005422 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001005422 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001005422 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001725362 Rosetta Predictions human pricing
XM_376469 Rosetta Predictions human pricing
XM_939163 Rosetta Predictions human pricing
XM_001058787 Rosetta Predictions rat pricing
XM_573997 Rosetta Predictions rat pricing
NM_001005422 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001725362 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00467238 predicted 1692
2 SASI_Hs02_00467239 predicted 1562
3 SASI_Hs02_00467240 predicted 1568
4 SASI_Hs02_00467241 predicted 1581
5 SASI_Hs02_00467242 predicted 1571
6 SASI_Hs02_00467243 predicted 1494
7 SASI_Hs02_00467244 predicted 1357
8 SASI_Hs02_00467245 predicted 1362
9 SASI_Hs02_00467246 predicted 1796
10 SASI_Hs02_00467247 predicted 1736
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_376469 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00274856 predicted 1689
2 SASI_Hs02_00479723 predicted 1557
3 SASI_Hs02_00479724 predicted 1573
4 SASI_Hs02_00479725 predicted 1581
5 SASI_Hs02_00479726 predicted 1570
6 SASI_Hs01_00274858 predicted 1744
7 SASI_Hs01_00274860 predicted 1798
8 SASI_Hs01_00274861 predicted 1735
9 SASI_Hs01_00274862 predicted 1738
10 SASI_Hs01_00274865 predicted 1843
11 SASI_Hs01_00274857 predicted 1844
12 SASI_Hs01_00274859 predicted 1731
13 SASI_Hs01_00274863 predicted 1675
14 SASI_Hs01_00274864 predicted 1800
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_939163 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00483502 predicted 1687
2 SASI_Hs02_00483503 predicted 1562
3 SASI_Hs02_00483504 predicted 1568
4 SASI_Hs02_00483505 predicted 1575
5 SASI_Hs02_00483506 predicted 1576
6 SASI_Hs02_00483507 predicted 1495
7 SASI_Hs02_00483508 predicted 1362
8 SASI_Hs02_00483509 predicted 1362
9 SASI_Hs02_00483510 predicted 1793
10 SASI_Hs02_00483511 predicted 1741
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001058787 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00290911 predicted 478
2 SASI_Rn02_00290912 predicted 329
3 SASI_Rn02_00290913 predicted 598
4 SASI_Rn02_00290914 predicted 705
5 SASI_Rn02_00290915 predicted 465
6 SASI_Rn02_00290916 predicted 505
7 SASI_Rn02_00290917 predicted 583
8 SASI_Rn02_00290918 predicted 332
9 SASI_Rn02_00290919 predicted 444
10 SASI_Rn02_00290920 predicted 702
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_573997 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00401170 predicted 475
2 SASI_Rn02_00401171 predicted 327
3 SASI_Rn02_00401172 predicted 602
4 SASI_Rn02_00401173 predicted 699
5 SASI_Rn02_00401174 predicted 461
6 SASI_Rn02_00401175 predicted 507
7 SASI_Rn02_00401176 predicted 578
8 SASI_Rn02_00401177 predicted 323
9 SASI_Rn02_00401178 predicted 449
10 SASI_Rn02_00401179 predicted 701
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005422 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00142548 predicted 596
2 SASI_Mm01_00142549 predicted 910
3 SASI_Mm02_00286588 predicted 846
4 SASI_Mm01_00142550 predicted 972
5 SASI_Mm01_00142551 predicted 441
6 SASI_Mm01_00142553 predicted 277
7 SASI_Mm01_00142554 predicted 861
8 SASI_Mm01_00142555 predicted 582
9 SASI_Mm01_00142556 predicted 927
10 SASI_Mm02_00286589 predicted 406
11 SASI_Mm01_00142552 predicted 824
12 SASI_Mm01_00142557 predicted 298
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001005422
STMND1 MISSION shRNA Bacterial Glycerol Stock
stathmin domain containing 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000200626    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005422.1-476s1c1
Sequence:CCGGCGGAGCAAAGTATTTAGAAATCTCGAGATTTCTAAATACTTTGCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200487    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001005422.1-1180s1c1
Sequence:CCGGCCAGCTTACCTAAATTATGTTCTCGAGAACATAATTTAGGTAAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191575    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005422.1-593s1c1
Sequence:CCGGGATTTCACAATCCAAGACATACTCGAGTATGTCTTGGATTGTGAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000283418    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005422.1-736s21c1
Sequence:CCGGCAGGGTGGAGGTTCCATTTACCTCGAGGTAAATGGAACCTCCACCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005422.1-450s21c1
Sequence:CCGGTAATTGTCCAAGGAATCATACCTCGAGGTATGATTCCTTGGACAATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215384    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005422.1-928s1c1
Sequence:CCGGCATATTCTGATAACGCCATTTCTCGAGAAATGGCGTTATCAGAATATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000283420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005422.1-912s21c1
Sequence:CCGGACAACCAAGAGGACAACATATCTCGAGATATGTTGTCCTCTTGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000283424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005422.1-472s21c1
Sequence:CCGGGAGCCGGAGCAAAGTATTTAGCTCGAGCTAAATACTTTGCTCCGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267034    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001005422.1-974s21c1
Sequence:CCGGCATGTTCTCCCGTAGTCTTAACTCGAGTTAAGACTACGGGAGAACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001005422
STMND1 MISSION shRNA shRNA Plasmid DNA
stathmin domain containing 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000200626    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005422.1-476s1c1
Sequence:CCGGCGGAGCAAAGTATTTAGAAATCTCGAGATTTCTAAATACTTTGCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200487    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001005422.1-1180s1c1
Sequence:CCGGCCAGCTTACCTAAATTATGTTCTCGAGAACATAATTTAGGTAAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191575    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005422.1-593s1c1
Sequence:CCGGGATTTCACAATCCAAGACATACTCGAGTATGTCTTGGATTGTGAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000283418    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005422.1-736s21c1
Sequence:CCGGCAGGGTGGAGGTTCCATTTACCTCGAGGTAAATGGAACCTCCACCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005422.1-450s21c1
Sequence:CCGGTAATTGTCCAAGGAATCATACCTCGAGGTATGATTCCTTGGACAATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215384    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005422.1-928s1c1
Sequence:CCGGCATATTCTGATAACGCCATTTCTCGAGAAATGGCGTTATCAGAATATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000283420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005422.1-912s21c1
Sequence:CCGGACAACCAAGAGGACAACATATCTCGAGATATGTTGTCCTCTTGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000283424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005422.1-472s21c1
Sequence:CCGGGAGCCGGAGCAAAGTATTTAGCTCGAGCTAAATACTTTGCTCCGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267034    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001005422.1-974s21c1
Sequence:CCGGCATGTTCTCCCGTAGTCTTAACTCGAGTTAAGACTACGGGAGAACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001005422
STMND1 MISSION shRNA Lentiviral Transduction Particles
stathmin domain containing 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000200626    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005422.1-476s1c1
Sequence:CCGGCGGAGCAAAGTATTTAGAAATCTCGAGATTTCTAAATACTTTGCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200487    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001005422.1-1180s1c1
Sequence:CCGGCCAGCTTACCTAAATTATGTTCTCGAGAACATAATTTAGGTAAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191575    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005422.1-593s1c1
Sequence:CCGGGATTTCACAATCCAAGACATACTCGAGTATGTCTTGGATTGTGAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000283418    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005422.1-736s21c1
Sequence:CCGGCAGGGTGGAGGTTCCATTTACCTCGAGGTAAATGGAACCTCCACCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267035    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005422.1-450s21c1
Sequence:CCGGTAATTGTCCAAGGAATCATACCTCGAGGTATGATTCCTTGGACAATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215384    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005422.1-928s1c1
Sequence:CCGGCATATTCTGATAACGCCATTTCTCGAGAAATGGCGTTATCAGAATATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000283420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005422.1-912s21c1
Sequence:CCGGACAACCAAGAGGACAACATATCTCGAGATATGTTGTCCTCTTGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000283424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005422.1-472s21c1
Sequence:CCGGGAGCCGGAGCAAAGTATTTAGCTCGAGCTAAATACTTTGCTCCGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267034    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001005422.1-974s21c1
Sequence:CCGGCATGTTCTCCCGTAGTCTTAACTCGAGTTAAGACTACGGGAGAACATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks