EMAIL THIS PAGE TO A FRIEND

STOM

stomatin

Synonyms: BND7 EPB7 EPB72
UniProtKB ID: P27105, B1AM77, Q14087, Q15609, Q5VX96, Q96FK4
Gene ID:
Human(2040) Summary: This gene encodes a member of a highly conserved family of integral membrane proteins. The encoded protein localizes to the cell membrane of red blood cells and other cell types, where it may regulate ion channels and transporters. Loss of localization of the encoded protein is associated with hereditary stomatocytosis, a form of hemolytic anemia. There is a pseudogene for this gene on chromosome 6. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2012]
Mouse(13830) stomatin
Rat(296655) stomatin
cow(100125834) stomatin
sheep(101115259) stomatin
Zebrafish(81534) stomatin
dog(612719) stomatin
chicken(417118) stomatin
72 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004099 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004099 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004099 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013515 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013515 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013515 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004099 Rosetta Predictions human pricing
NM_198194 Rosetta Predictions human pricing
NM_001011965 Rosetta Predictions rat pricing
XM_575120 Rosetta Predictions rat pricing
NM_013515 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004099 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00046548 predicted 1098
2 SASI_Hs01_00046549 predicted 1133
3 SASI_Hs01_00046550 predicted 1114
4 SASI_Hs01_00046551 predicted 1081
5 SASI_Hs01_00046553 predicted 440
6 SASI_Hs01_00046555 predicted 272
7 SASI_Hs01_00046556 predicted 253
8 SASI_Hs02_00336910 predicted 649
9 SASI_Hs01_00046557 predicted 188
10 SASI_Hs02_00336911 predicted 472
11 SASI_Hs01_00046552 predicted 994
12 SASI_Hs01_00046554 predicted 360
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198194 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00235556 predicted 601
2 SASI_Hs01_00235557 predicted 635
3 SASI_Hs01_00235558 predicted 625
4 SASI_Hs01_00235559 predicted 586
5 SASI_Hs01_00235561 predicted 563
6 SASI_Hs01_00235562 predicted 201
7 SASI_Hs01_00235563 predicted 432
8 SASI_Hs01_00235564 predicted 187
9 SASI_Hs02_00371732 predicted 187
10 SASI_Hs01_00235565 predicted 770
11 SASI_Hs01_00235560 predicted 507
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001011965 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00086199 predicted 482
2 SASI_Rn01_00086200 predicted 1023
3 SASI_Rn01_00086201 predicted 735
4 SASI_Rn01_00086202 predicted 1293
5 SASI_Rn01_00086203 predicted 355
6 SASI_Rn01_00086204 predicted 415
7 SASI_Rn01_00086205 predicted 678
8 SASI_Rn01_00086206 predicted 1114
9 SASI_Rn02_00199984 predicted 533
10 SASI_Rn01_00086207 predicted 215
11 SASI_Rn01_00086198 predicted 260
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_575120 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00192111 predicted 1709
2 SASI_Rn01_00192112 predicted 1933
3 SASI_Rn01_00192113 predicted 2478
4 SASI_Rn01_00192114 predicted 2182
5 SASI_Rn01_00192115 predicted 2750
6 SASI_Rn01_00192116 predicted 1810
7 SASI_Rn01_00192117 predicted 1864
8 SASI_Rn01_00192118 predicted 2129
9 SASI_Rn01_00192119 predicted 2574
10 SASI_Rn01_00192120 predicted 1668
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013515 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00322188 predicted 309
2 SASI_Mm01_00200861 predicted 486
3 SASI_Mm01_00200862 predicted 999
4 SASI_Mm01_00200863 predicted 1017
5 SASI_Mm01_00200864 predicted 266
6 SASI_Mm01_00200865 predicted 582
7 SASI_Mm01_00200866 predicted 227
8 SASI_Mm01_00200867 predicted 360
9 SASI_Mm01_00200868 predicted 969
10 SASI_Mm01_00200869 predicted 278
11 SASI_Mm01_00200860 predicted 797
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004099
STOM MISSION shRNA Bacterial Glycerol Stock
stomatin
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000319395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004099.4-203s21c1
Sequence:CCGGCACCGTTATAACTTTCCCAATCTCGAGATTGGGAAAGTTATAACGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004099.4-895s21c1
Sequence:CCGGCCATAGATATGCTGCAAGGAACTCGAGTTCCTTGCAGCATATCTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319308    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004099.4-272s21c1
Sequence:CCGGCATCTTTAGATTGGGTCGCATCTCGAGATGCGACCCAATCTAAAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004099.4-430s21c1
Sequence:CCGGGCGTGGATGGTGTGGTCTATTCTCGAGAATAGACCACACCATCCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004099.4-654s1c1
Sequence:CCGGGTGGAAATTAAGGATGTGAAACTCGAGTTTCACATCCTTAATTTCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004099.4-895s1c1
Sequence:CCGGCCATAGATATGCTGCAAGGAACTCGAGTTCCTTGCAGCATATCTATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004099.4-203s1c1
Sequence:CCGGCACCGTTATAACTTTCCCAATCTCGAGATTGGGAAAGTTATAACGGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004099.4-430s1c1
Sequence:CCGGGCGTGGATGGTGTGGTCTATTCTCGAGAATAGACCACACCATCCACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004099.4-272s1c1
Sequence:CCGGCATCTTTAGATTGGGTCGCATCTCGAGATGCGACCCAATCTAAAGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004099
STOM MISSION shRNA shRNA Plasmid DNA
stomatin
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000319395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004099.4-203s21c1
Sequence:CCGGCACCGTTATAACTTTCCCAATCTCGAGATTGGGAAAGTTATAACGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004099.4-895s21c1
Sequence:CCGGCCATAGATATGCTGCAAGGAACTCGAGTTCCTTGCAGCATATCTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319308    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004099.4-272s21c1
Sequence:CCGGCATCTTTAGATTGGGTCGCATCTCGAGATGCGACCCAATCTAAAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004099.4-430s21c1
Sequence:CCGGGCGTGGATGGTGTGGTCTATTCTCGAGAATAGACCACACCATCCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004099.4-654s1c1
Sequence:CCGGGTGGAAATTAAGGATGTGAAACTCGAGTTTCACATCCTTAATTTCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004099.4-895s1c1
Sequence:CCGGCCATAGATATGCTGCAAGGAACTCGAGTTCCTTGCAGCATATCTATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004099.4-203s1c1
Sequence:CCGGCACCGTTATAACTTTCCCAATCTCGAGATTGGGAAAGTTATAACGGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004099.4-430s1c1
Sequence:CCGGGCGTGGATGGTGTGGTCTATTCTCGAGAATAGACCACACCATCCACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004099.4-272s1c1
Sequence:CCGGCATCTTTAGATTGGGTCGCATCTCGAGATGCGACCCAATCTAAAGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004099
STOM MISSION shRNA Lentiviral Transduction Particles
stomatin
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000319395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004099.4-203s21c1
Sequence:CCGGCACCGTTATAACTTTCCCAATCTCGAGATTGGGAAAGTTATAACGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004099.4-895s21c1
Sequence:CCGGCCATAGATATGCTGCAAGGAACTCGAGTTCCTTGCAGCATATCTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319308    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004099.4-272s21c1
Sequence:CCGGCATCTTTAGATTGGGTCGCATCTCGAGATGCGACCCAATCTAAAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319309    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004099.4-430s21c1
Sequence:CCGGGCGTGGATGGTGTGGTCTATTCTCGAGAATAGACCACACCATCCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004099.4-654s1c1
Sequence:CCGGGTGGAAATTAAGGATGTGAAACTCGAGTTTCACATCCTTAATTTCCACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029160    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004099.4-895s1c1
Sequence:CCGGCCATAGATATGCTGCAAGGAACTCGAGTTCCTTGCAGCATATCTATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029161    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004099.4-203s1c1
Sequence:CCGGCACCGTTATAACTTTCCCAATCTCGAGATTGGGAAAGTTATAACGGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029163    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004099.4-430s1c1
Sequence:CCGGGCGTGGATGGTGTGGTCTATTCTCGAGAATAGACCACACCATCCACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029162    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004099.4-272s1c1
Sequence:CCGGCATCTTTAGATTGGGTCGCATCTCGAGATGCGACCCAATCTAAAGATGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013515
VALIDATED
STOM MISSION shRNA Bacterial Glycerol Stock
stomatin
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000302817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013515.2-484s21c1
Sequence:CCGGGCTGTGGCCAATATCACCAATCTCGAGATTGGTGATATTGGCCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302744    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013515.2-213s21c1
Sequence:CCGGCGTAATTATAACCTTCCCAATCTCGAGATTGGGAAGGTTATAATTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302745    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013515.2-919s21c1
Sequence:CCGGCAGGGCATCATGGGTTCTAATCTCGAGATTAGAACCCATGATGCCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302818    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013515.2-1216s21c1
Sequence:CCGGGCTTGTAAATAACGAGAGAATCTCGAGATTCTCTCGTTATTTACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013515.2-378s21c1
Sequence:CCGGGAGGACCATCTCCTTTGACATCTCGAGATGTCAAAGGAGATGGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112910    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013515.1-1218s1c1
Sequence:CCGGGCTTGTAAATAACGAGAGAATCTCGAGATTCTCTCGTTATTTACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013515.1-484s1c1
Sequence:CCGGGCTGTGGCCAATATCACCAATCTCGAGATTGGTGATATTGGCCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013515.1-919s1c1
Sequence:CCGGCAGGGCATCATGGGTTCTAATCTCGAGATTAGAACCCATGATGCCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013515.1-213s1c1
Sequence:CCGGCGTAATTATAACCTTCCCAATCTCGAGATTGGGAAGGTTATAATTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013515.1-378s1c1
Sequence:CCGGGAGGACCATCTCCTTTGACATCTCGAGATGTCAAAGGAGATGGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013515
VALIDATED
STOM MISSION shRNA shRNA Plasmid DNA
stomatin
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000302817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013515.2-484s21c1
Sequence:CCGGGCTGTGGCCAATATCACCAATCTCGAGATTGGTGATATTGGCCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302744    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013515.2-213s21c1
Sequence:CCGGCGTAATTATAACCTTCCCAATCTCGAGATTGGGAAGGTTATAATTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302745    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013515.2-919s21c1
Sequence:CCGGCAGGGCATCATGGGTTCTAATCTCGAGATTAGAACCCATGATGCCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302818    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013515.2-1216s21c1
Sequence:CCGGGCTTGTAAATAACGAGAGAATCTCGAGATTCTCTCGTTATTTACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013515.2-378s21c1
Sequence:CCGGGAGGACCATCTCCTTTGACATCTCGAGATGTCAAAGGAGATGGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112910    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013515.1-1218s1c1
Sequence:CCGGGCTTGTAAATAACGAGAGAATCTCGAGATTCTCTCGTTATTTACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013515.1-484s1c1
Sequence:CCGGGCTGTGGCCAATATCACCAATCTCGAGATTGGTGATATTGGCCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013515.1-919s1c1
Sequence:CCGGCAGGGCATCATGGGTTCTAATCTCGAGATTAGAACCCATGATGCCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013515.1-213s1c1
Sequence:CCGGCGTAATTATAACCTTCCCAATCTCGAGATTGGGAAGGTTATAATTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013515.1-378s1c1
Sequence:CCGGGAGGACCATCTCCTTTGACATCTCGAGATGTCAAAGGAGATGGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013515
VALIDATED
STOM MISSION shRNA Lentiviral Transduction Particles
stomatin
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000302817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013515.2-484s21c1
Sequence:CCGGGCTGTGGCCAATATCACCAATCTCGAGATTGGTGATATTGGCCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302744    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013515.2-213s21c1
Sequence:CCGGCGTAATTATAACCTTCCCAATCTCGAGATTGGGAAGGTTATAATTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302745    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013515.2-919s21c1
Sequence:CCGGCAGGGCATCATGGGTTCTAATCTCGAGATTAGAACCCATGATGCCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302818    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013515.2-1216s21c1
Sequence:CCGGGCTTGTAAATAACGAGAGAATCTCGAGATTCTCTCGTTATTTACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315534    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013515.2-378s21c1
Sequence:CCGGGAGGACCATCTCCTTTGACATCTCGAGATGTCAAAGGAGATGGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112910    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013515.1-1218s1c1
Sequence:CCGGGCTTGTAAATAACGAGAGAATCTCGAGATTCTCTCGTTATTTACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112912    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013515.1-484s1c1
Sequence:CCGGGCTGTGGCCAATATCACCAATCTCGAGATTGGTGATATTGGCCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013515.1-919s1c1
Sequence:CCGGCAGGGCATCATGGGTTCTAATCTCGAGATTAGAACCCATGATGCCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013515.1-213s1c1
Sequence:CCGGCGTAATTATAACCTTCCCAATCTCGAGATTGGGAAGGTTATAATTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013515.1-378s1c1
Sequence:CCGGGAGGACCATCTCCTTTGACATCTCGAGATGTCAAAGGAGATGGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks