EMAIL THIS PAGE TO A FRIEND

STOML1

stomatin (EPB72)-like 1

Synonyms: SLP-1 STORP hUNC-24
Gene ID:
Mouse(69106) stomatin-like 1
Rat(300748) stomatin (EPB72)-like 1
Zebrafish(563294) stomatin (EPB72)-like 1
domestic cat(101089362) stomatin (EPB72)-like 1
Horse(100062776) stomatin (EPB72)-like 1
dog(487640) stomatin (EPB72)-like 1
chicken(415303) stomatin (EPB72)-like 1
domestic guinea pig(100717883) stomatin (EPB72)-like 1
naked mole-rat(101709054) stomatin (EPB72)-like 1
cow(540438) stomatin (EPB72)-like 1
sheep(101111834) stomatin (EPB72)-like 1
55 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004809 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004809 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004809 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026942 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026942 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026942 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU060171 MISSION® esiRNA esiRNA human STOML1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004809 Rosetta Predictions human pricing
XM_001074725 Rosetta Predictions rat pricing
XM_236297 Rosetta Predictions rat pricing
NM_026942 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004809 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00027886 predicted 492
2 SASI_Hs01_00027887 predicted 453
3 SASI_Hs01_00027888 predicted 1049
4 SASI_Hs01_00027889 predicted 1560
5 SASI_Hs01_00027890 predicted 996
6 SASI_Hs01_00027891 predicted 223
7 SASI_Hs01_00027892 predicted 321
8 SASI_Hs02_00338353 predicted 228
9 SASI_Hs01_00027894 predicted 1057
10 SASI_Hs01_00027895 predicted 1618
11 SASI_Hs01_00027893 predicted 371
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001074725 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00347154 predicted 1358
2 SASI_Rn02_00347155 predicted 890
3 SASI_Rn02_00347156 predicted 1663
4 SASI_Rn02_00347157 predicted 1483
5 SASI_Rn02_00347158 predicted 1353
6 SASI_Rn02_00347159 predicted 482
7 SASI_Rn02_00347160 predicted 1670
8 SASI_Rn02_00347161 predicted 1670
9 SASI_Rn02_00347162 predicted 357
10 SASI_Rn02_00347163 predicted 356
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_236297 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00389954 predicted 610
2 SASI_Rn02_00389955 predicted 345
3 SASI_Rn02_00389956 predicted 464
4 SASI_Rn02_00389957 predicted 404
5 SASI_Rn02_00389958 predicted 302
6 SASI_Rn02_00389959 predicted 485
7 SASI_Rn02_00389960 predicted 451
8 SASI_Rn02_00389961 predicted 351
9 SASI_Rn02_00389962 predicted 355
10 SASI_Rn02_00389963 predicted 543
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026942 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00166821 predicted 319
2 SASI_Mm01_00166822 predicted 1343
3 SASI_Mm01_00166823 predicted 1320
4 SASI_Mm01_00166824 predicted 1050
5 SASI_Mm01_00166825 predicted 315
6 SASI_Mm01_00166826 predicted 331
7 SASI_Mm01_00166827 predicted 728
8 SASI_Mm01_00166828 predicted 1163
9 SASI_Mm01_00166829 predicted 501
10 SASI_Mm01_00166830 predicted 1333
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004809
STOML1 MISSION shRNA Bacterial Glycerol Stock
stomatin (EPB72)-like 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000156454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004809.3-660s1c1
Sequence:CCGGCTTCTGCTGGAGATCAACGATCTCGAGATCGTTGATCTCCAGCAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004809.3-539s1c1
Sequence:CCGGGATGACTGTGAAAGACCTGAACTCGAGTTCAGGTCTTTCACAGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004809.3-629s1c1
Sequence:CCGGCCAGATGGAGAAGCTCAAGATCTCGAGATCTTGAGCTTCTCCATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004809.3-870s1c1
Sequence:CCGGGTGGAGATGGTGAGTGAAGTTCTCGAGAACTTCACTCACCATCTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156635    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004809.3-395s1c1
Sequence:CCGGGCCCTTCATTGACTCCTTTCACTCGAGTGAAAGGAGTCAATGAAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004809.3-626s1c1
Sequence:CCGGGATCCAGATGGAGAAGCTCAACTCGAGTTGAGCTTCTCCATCTGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000442252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004809.3-499s21c1
Sequence:CCGGCCGATGTCCAGTTTCGCATCTCTCGAGAGATGCGAAACTGGACATCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004809.3-234s21c1
Sequence:CCGGTGTCATGGCCTCATCAGTTTCCTCGAGGAAACTGATGAGGCCATGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436277    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004809.3-1360s21c1
Sequence:CCGGAGAGTTGAGGCCCTAACAAATCTCGAGATTTGTTAGGGCCTCAACTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004809
STOML1 MISSION shRNA shRNA Plasmid DNA
stomatin (EPB72)-like 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000156454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004809.3-660s1c1
Sequence:CCGGCTTCTGCTGGAGATCAACGATCTCGAGATCGTTGATCTCCAGCAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004809.3-539s1c1
Sequence:CCGGGATGACTGTGAAAGACCTGAACTCGAGTTCAGGTCTTTCACAGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004809.3-629s1c1
Sequence:CCGGCCAGATGGAGAAGCTCAAGATCTCGAGATCTTGAGCTTCTCCATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004809.3-870s1c1
Sequence:CCGGGTGGAGATGGTGAGTGAAGTTCTCGAGAACTTCACTCACCATCTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156635    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004809.3-395s1c1
Sequence:CCGGGCCCTTCATTGACTCCTTTCACTCGAGTGAAAGGAGTCAATGAAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004809.3-626s1c1
Sequence:CCGGGATCCAGATGGAGAAGCTCAACTCGAGTTGAGCTTCTCCATCTGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000442252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004809.3-499s21c1
Sequence:CCGGCCGATGTCCAGTTTCGCATCTCTCGAGAGATGCGAAACTGGACATCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004809.3-234s21c1
Sequence:CCGGTGTCATGGCCTCATCAGTTTCCTCGAGGAAACTGATGAGGCCATGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436277    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004809.3-1360s21c1
Sequence:CCGGAGAGTTGAGGCCCTAACAAATCTCGAGATTTGTTAGGGCCTCAACTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004809
STOML1 MISSION shRNA Lentiviral Transduction Particles
stomatin (EPB72)-like 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000156454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004809.3-660s1c1
Sequence:CCGGCTTCTGCTGGAGATCAACGATCTCGAGATCGTTGATCTCCAGCAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004809.3-539s1c1
Sequence:CCGGGATGACTGTGAAAGACCTGAACTCGAGTTCAGGTCTTTCACAGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157629    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004809.3-629s1c1
Sequence:CCGGCCAGATGGAGAAGCTCAAGATCTCGAGATCTTGAGCTTCTCCATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004809.3-870s1c1
Sequence:CCGGGTGGAGATGGTGAGTGAAGTTCTCGAGAACTTCACTCACCATCTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156635    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_004809.3-395s1c1
Sequence:CCGGGCCCTTCATTGACTCCTTTCACTCGAGTGAAAGGAGTCAATGAAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004809.3-626s1c1
Sequence:CCGGGATCCAGATGGAGAAGCTCAACTCGAGTTGAGCTTCTCCATCTGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000442252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004809.3-499s21c1
Sequence:CCGGCCGATGTCCAGTTTCGCATCTCTCGAGAGATGCGAAACTGGACATCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004809.3-234s21c1
Sequence:CCGGTGTCATGGCCTCATCAGTTTCCTCGAGGAAACTGATGAGGCCATGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436277    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004809.3-1360s21c1
Sequence:CCGGAGAGTTGAGGCCCTAACAAATCTCGAGATTTGTTAGGGCCTCAACTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026942
VALIDATED
STOML1 MISSION shRNA Bacterial Glycerol Stock
stomatin (EPB72)-like 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000111764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026942.2-1050s1c1
Sequence:CCGGCCAGAGTATCTACTTCCTGGACTCGAGTCCAGGAAGTAGATACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026942.2-396s1c1
Sequence:CCGGCCTGCCCTTTATTGACTCCTTCTCGAGAAGGAGTCAATAAAGGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026942.2-399s1c1
Sequence:CCGGGCCCTTTATTGACTCCTTCCACTCGAGTGGAAGGAGTCAATAAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111761    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026942.2-322s1c1
Sequence:CCGGCCCACCTATGAGAGGATGATTCTCGAGAATCATCCTCTCATAGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111760    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026942.2-1378s1c1
Sequence:CCGGCTGAAGATGTTTCAGTCCCAACTCGAGTTGGGACTGAAACATCTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026942
VALIDATED
STOML1 MISSION shRNA shRNA Plasmid DNA
stomatin (EPB72)-like 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000111764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026942.2-1050s1c1
Sequence:CCGGCCAGAGTATCTACTTCCTGGACTCGAGTCCAGGAAGTAGATACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026942.2-396s1c1
Sequence:CCGGCCTGCCCTTTATTGACTCCTTCTCGAGAAGGAGTCAATAAAGGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026942.2-399s1c1
Sequence:CCGGGCCCTTTATTGACTCCTTCCACTCGAGTGGAAGGAGTCAATAAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111761    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026942.2-322s1c1
Sequence:CCGGCCCACCTATGAGAGGATGATTCTCGAGAATCATCCTCTCATAGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111760    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026942.2-1378s1c1
Sequence:CCGGCTGAAGATGTTTCAGTCCCAACTCGAGTTGGGACTGAAACATCTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026942
VALIDATED
STOML1 MISSION shRNA Lentiviral Transduction Particles
stomatin (EPB72)-like 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000111764    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026942.2-1050s1c1
Sequence:CCGGCCAGAGTATCTACTTCCTGGACTCGAGTCCAGGAAGTAGATACTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111762    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026942.2-396s1c1
Sequence:CCGGCCTGCCCTTTATTGACTCCTTCTCGAGAAGGAGTCAATAAAGGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111763    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026942.2-399s1c1
Sequence:CCGGGCCCTTTATTGACTCCTTCCACTCGAGTGGAAGGAGTCAATAAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111761    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026942.2-322s1c1
Sequence:CCGGCCCACCTATGAGAGGATGATTCTCGAGAATCATCCTCTCATAGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111760    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026942.2-1378s1c1
Sequence:CCGGCTGAAGATGTTTCAGTCCCAACTCGAGTTGGGACTGAAACATCTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks