EMAIL THIS PAGE TO A FRIEND

STOML2

stomatin (EPB72)-like 2

Synonyms: SLP-2
UniProtKB ID: Q9UJZ1, D3DRN3, O60376, Q53G29, Q96FY2, Q9P042
Gene ID:
Mouse(66592) stomatin (Epb7.2)-like 2
Rat(298203) stomatin (Epb7.2)-like 2
cow(510324) stomatin (EPB72)-like 2
sheep(101118247) stomatin (EPB72)-like 2
naked mole-rat(101715609) stomatin (EPB72)-like 2
domestic guinea pig(100728527) stomatin (EPB72)-like 2
Zebrafish(394006) stomatin (EPB72)-like 2
Horse(100055756) stomatin (EPB72)-like 2
domestic cat(101088700) stomatin (EPB72)-like 2
dog(474755) stomatin (EPB72)-like 2
chicken(427412) stomatin (EPB72)-like 2
57 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013442 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_013442 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_013442 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_023231 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023231 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023231 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU145711 MISSION® esiRNA esiRNA human STOML2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_013442 Rosetta Predictions human pricing
NM_001031646 Rosetta Predictions rat pricing
NM_023231 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013442 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00014726 predicted 514
2 SASI_Hs01_00014727 predicted 260
3 SASI_Hs01_00014728 predicted 368
4 SASI_Hs01_00014729 predicted 652
5 SASI_Hs01_00014730 predicted 926
6 SASI_Hs01_00014731 predicted 227
7 SASI_Hs01_00014732 predicted 560
8 SASI_Hs01_00014733 predicted 685
9 SASI_Hs02_00344846 predicted 423
10 SASI_Hs02_00344847 predicted 576
11 SASI_Hs01_00014725 predicted 418
12 SASI_Hs01_00014734 predicted 481
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001031646 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00054958 predicted 274
2 SASI_Rn01_00054959 predicted 300
3 SASI_Rn01_00054960 predicted 514
4 SASI_Rn01_00054961 predicted 200
5 SASI_Rn01_00054962 predicted 504
6 SASI_Rn01_00054963 predicted 455
7 SASI_Rn01_00054964 predicted 298
8 SASI_Rn01_00054965 predicted 606
9 SASI_Rn02_00203582 predicted 477
10 SASI_Rn01_00054966 predicted 264
11 SASI_Rn01_00054967 predicted 511
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023231 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00071383 predicted 279
2 SASI_Mm01_00071384 predicted 762
3 SASI_Mm01_00071385 predicted 241
4 SASI_Mm01_00071386 predicted 207
5 SASI_Mm01_00071388 predicted 383
6 SASI_Mm01_00071389 predicted 616
7 SASI_Mm01_00071390 predicted 412
8 SASI_Mm01_00071391 predicted 303
9 SASI_Mm01_00071392 predicted 486
10 SASI_Mm02_00326984 predicted 417
11 SASI_Mm01_00071387 predicted 476
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013442
VALIDATED
STOML2 MISSION shRNA Bacterial Glycerol Stock
stomatin (EPB72)-like 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000438004    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013442.1-464s21c1
Sequence:CCGGTGAGATCAGAGCTCGGCAAACCTCGAGGTTTGCCGAGCTCTGATCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013442.1-269s21c1
Sequence:CCGGTGTTAGACCGGATCCGATATGCTCGAGCATATCGGATCCGGTCTAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_013442.1-360s1c1
Sequence:CCGGGCAAATCGATGGAGTCCTTTACTCGAGTAAAGGACTCCATCGATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_013442.1-345s1c1
Sequence:CCGGCGACAATGTAACTCTGCAAATCTCGAGATTTGCAGAGTTACATTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149321    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_013442.1-1090s1c1
Sequence:CCGGGATGCAAGTCTTGATGAGGAACTCGAGTTCCTCATCAAGACTTGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_013442.1-816s1c1
Sequence:CCGGCAAGGCTAAAGCTGAAGCTATCTCGAGATAGCTTCAGCTTTAGCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147002    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_013442.1-582s1c1
Sequence:CCGGCCGTTATGAGATCAAGGATATCTCGAGATATCCTTGATCTCATAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013442
VALIDATED
STOML2 MISSION shRNA shRNA Plasmid DNA
stomatin (EPB72)-like 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000438004    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013442.1-464s21c1
Sequence:CCGGTGAGATCAGAGCTCGGCAAACCTCGAGGTTTGCCGAGCTCTGATCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013442.1-269s21c1
Sequence:CCGGTGTTAGACCGGATCCGATATGCTCGAGCATATCGGATCCGGTCTAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_013442.1-360s1c1
Sequence:CCGGGCAAATCGATGGAGTCCTTTACTCGAGTAAAGGACTCCATCGATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_013442.1-345s1c1
Sequence:CCGGCGACAATGTAACTCTGCAAATCTCGAGATTTGCAGAGTTACATTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149321    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_013442.1-1090s1c1
Sequence:CCGGGATGCAAGTCTTGATGAGGAACTCGAGTTCCTCATCAAGACTTGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_013442.1-816s1c1
Sequence:CCGGCAAGGCTAAAGCTGAAGCTATCTCGAGATAGCTTCAGCTTTAGCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147002    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_013442.1-582s1c1
Sequence:CCGGCCGTTATGAGATCAAGGATATCTCGAGATATCCTTGATCTCATAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013442
VALIDATED
STOML2 MISSION shRNA Lentiviral Transduction Particles
stomatin (EPB72)-like 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000438004    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013442.1-464s21c1
Sequence:CCGGTGAGATCAGAGCTCGGCAAACCTCGAGGTTTGCCGAGCTCTGATCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421088    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013442.1-269s21c1
Sequence:CCGGTGTTAGACCGGATCCGATATGCTCGAGCATATCGGATCCGGTCTAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_013442.1-360s1c1
Sequence:CCGGGCAAATCGATGGAGTCCTTTACTCGAGTAAAGGACTCCATCGATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_013442.1-345s1c1
Sequence:CCGGCGACAATGTAACTCTGCAAATCTCGAGATTTGCAGAGTTACATTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149321    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_013442.1-1090s1c1
Sequence:CCGGGATGCAAGTCTTGATGAGGAACTCGAGTTCCTCATCAAGACTTGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_013442.1-816s1c1
Sequence:CCGGCAAGGCTAAAGCTGAAGCTATCTCGAGATAGCTTCAGCTTTAGCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147002    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_013442.1-582s1c1
Sequence:CCGGCCGTTATGAGATCAAGGATATCTCGAGATATCCTTGATCTCATAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023231
VALIDATED
STOML2 MISSION shRNA Bacterial Glycerol Stock
stomatin (EPB72)-like 2
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000328694    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023231.2-1300s21c1
Sequence:CCGGGTCGGTGTGAGGAGTTGATTCCTCGAGGAATCAACTCCTCACACCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023231.2-427s21c1
Sequence:CCGGGCAAACTCTCTCTGGACAAAGCTCGAGCTTTGTCCAGAGAGAGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023231.2-1057s21c1
Sequence:CCGGGAGTCAAGCTCAGTTAGTAGACTCGAGTCTACTAACTGAGCTTGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216297    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023231.2-294s1c1
Sequence:CCGGGACAATGTAACACTACAAATACTCGAGTATTTGTAGTGTTACATTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217323    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023231.2-342s1c1
Sequence:CCGGGATCCTTACAAGGCAAGTTACCTCGAGGTAACTTGCCTTGTAAGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023231.2-295s21c1
Sequence:CCGGACAATGTAACACTACAAATAGCTCGAGCTATTTGTAGTGTTACATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328693    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023231.2-236s21c1
Sequence:CCGGTGTGCAGAGTCTCAAGGAAATCTCGAGATTTCCTTGAGACTCTGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176258    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023231.2-1332s1c1
Sequence:CCGGCAAGGATTCACTTCATGTGAACTCGAGTTCACATGAAGTGAATCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175529    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023231.2-1342s1c1
Sequence:CCGGCTTCATGTGAAGTGAAGTCATCTCGAGATGACTTCACTTCACATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173985    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023231.2-462s1c1
Sequence:CCGGGAGTCCCTGAATGCCAACATTCTCGAGAATGTTGGCATTCAGGGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023231.2-1036s1c1
Sequence:CCGGCGAGTATTGAAGAACTGGGTACTCGAGTACCCAGTTCTTCAATACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173686    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023231.2-1209s1c1
Sequence:CCGGCAAATGGGAAACTGTCCTCATCTCGAGATGAGGACAGTTTCCCATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194539    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023231.2-638s1c1
Sequence:CCGGGACACGAGAGTCAGCTATTAACTCGAGTTAATAGCTGACTCTCGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023231
VALIDATED
STOML2 MISSION shRNA shRNA Plasmid DNA
stomatin (EPB72)-like 2
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000328694    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023231.2-1300s21c1
Sequence:CCGGGTCGGTGTGAGGAGTTGATTCCTCGAGGAATCAACTCCTCACACCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023231.2-427s21c1
Sequence:CCGGGCAAACTCTCTCTGGACAAAGCTCGAGCTTTGTCCAGAGAGAGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023231.2-1057s21c1
Sequence:CCGGGAGTCAAGCTCAGTTAGTAGACTCGAGTCTACTAACTGAGCTTGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216297    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023231.2-294s1c1
Sequence:CCGGGACAATGTAACACTACAAATACTCGAGTATTTGTAGTGTTACATTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217323    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023231.2-342s1c1
Sequence:CCGGGATCCTTACAAGGCAAGTTACCTCGAGGTAACTTGCCTTGTAAGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023231.2-295s21c1
Sequence:CCGGACAATGTAACACTACAAATAGCTCGAGCTATTTGTAGTGTTACATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328693    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023231.2-236s21c1
Sequence:CCGGTGTGCAGAGTCTCAAGGAAATCTCGAGATTTCCTTGAGACTCTGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176258    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023231.2-1332s1c1
Sequence:CCGGCAAGGATTCACTTCATGTGAACTCGAGTTCACATGAAGTGAATCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175529    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023231.2-1342s1c1
Sequence:CCGGCTTCATGTGAAGTGAAGTCATCTCGAGATGACTTCACTTCACATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173985    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023231.2-462s1c1
Sequence:CCGGGAGTCCCTGAATGCCAACATTCTCGAGAATGTTGGCATTCAGGGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023231.2-1036s1c1
Sequence:CCGGCGAGTATTGAAGAACTGGGTACTCGAGTACCCAGTTCTTCAATACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173686    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023231.2-1209s1c1
Sequence:CCGGCAAATGGGAAACTGTCCTCATCTCGAGATGAGGACAGTTTCCCATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194539    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023231.2-638s1c1
Sequence:CCGGGACACGAGAGTCAGCTATTAACTCGAGTTAATAGCTGACTCTCGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023231
VALIDATED
STOML2 MISSION shRNA Lentiviral Transduction Particles
stomatin (EPB72)-like 2
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000328694    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023231.2-1300s21c1
Sequence:CCGGGTCGGTGTGAGGAGTTGATTCCTCGAGGAATCAACTCCTCACACCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328695    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023231.2-427s21c1
Sequence:CCGGGCAAACTCTCTCTGGACAAAGCTCGAGCTTTGTCCAGAGAGAGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023231.2-1057s21c1
Sequence:CCGGGAGTCAAGCTCAGTTAGTAGACTCGAGTCTACTAACTGAGCTTGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216297    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023231.2-294s1c1
Sequence:CCGGGACAATGTAACACTACAAATACTCGAGTATTTGTAGTGTTACATTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217323    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023231.2-342s1c1
Sequence:CCGGGATCCTTACAAGGCAAGTTACCTCGAGGTAACTTGCCTTGTAAGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328620    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023231.2-295s21c1
Sequence:CCGGACAATGTAACACTACAAATAGCTCGAGCTATTTGTAGTGTTACATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328693    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023231.2-236s21c1
Sequence:CCGGTGTGCAGAGTCTCAAGGAAATCTCGAGATTTCCTTGAGACTCTGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176258    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023231.2-1332s1c1
Sequence:CCGGCAAGGATTCACTTCATGTGAACTCGAGTTCACATGAAGTGAATCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175529    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023231.2-1342s1c1
Sequence:CCGGCTTCATGTGAAGTGAAGTCATCTCGAGATGACTTCACTTCACATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173985    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023231.2-462s1c1
Sequence:CCGGGAGTCCCTGAATGCCAACATTCTCGAGAATGTTGGCATTCAGGGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173206    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023231.2-1036s1c1
Sequence:CCGGCGAGTATTGAAGAACTGGGTACTCGAGTACCCAGTTCTTCAATACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173686    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023231.2-1209s1c1
Sequence:CCGGCAAATGGGAAACTGTCCTCATCTCGAGATGAGGACAGTTTCCCATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194539    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023231.2-638s1c1
Sequence:CCGGGACACGAGAGTCAGCTATTAACTCGAGTTAATAGCTGACTCTCGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks