EMAIL THIS PAGE TO A FRIEND

STOML3

stomatin (EPB72)-like 3

Synonyms: Epb7.2l SRO
UniProtKB ID: Q8TAV4, B4E285, Q5JS35
Gene ID:
Mouse(229277) stomatin (Epb7.2)-like 3
Rat(295041) stomatin (Epb7.2)-like 3
chicken(428074) stomatin (EPB72)-like 3
dog(486001) stomatin (EPB72)-like 3
domestic cat(101087546) stomatin (EPB72)-like 3
domestic guinea pig(100719541) stomatin (EPB72)-like 3
naked mole-rat(101714072) stomatin (EPB72)-like 3
cow(519212) stomatin (EPB72)-like 3
sheep(101123310) stomatin (EPB72)-like 3
48 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA012892 Anti-STOML3 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
SAB2103862 Anti-STOML3 antibody produced in rabbit affinity isolated antibody rabbit, guinea pig, mouse, rat, horse, bovine, human
western blot pricing
SAB2103861 Anti-STOML3, (N-terminal) antibody produced in rabbit affinity isolated antibody guinea pig, rabbit, human, horse, mouse, rat, bovine
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145286 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145286 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145286 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_153156 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153156 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153156 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_145286 Rosetta Predictions human pricing
NM_001106431 Rosetta Predictions rat pricing
NM_153156 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145286 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00028878 predicted 534
2 SASI_Hs01_00028879 predicted 601
3 SASI_Hs01_00028880 predicted 284
4 SASI_Hs01_00028881 predicted 1075
5 SASI_Hs01_00028882 predicted 565
6 SASI_Hs01_00028883 predicted 554
7 SASI_Hs01_00028884 predicted 1022
8 SASI_Hs02_00365168 predicted 1057
9 SASI_Hs01_00028886 predicted 195
10 SASI_Hs01_00028887 predicted 1053
11 SASI_Hs01_00028885 predicted 969
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106431 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00218898 predicted 504
2 SASI_Rn02_00218899 predicted 277
3 SASI_Rn02_00218900 predicted 252
4 SASI_Rn02_00218901 predicted 546
5 SASI_Rn02_00218902 predicted 568
6 SASI_Rn02_00218903 predicted 556
7 SASI_Rn02_00218904 predicted 236
8 SASI_Rn02_00218905 predicted 601
9 SASI_Rn02_00218906 predicted 614
10 SASI_Rn02_00218907 predicted 587
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153156 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00094043 predicted 250
2 SASI_Mm01_00094045 predicted 262
3 SASI_Mm01_00094046 predicted 446
4 SASI_Mm02_00343046 predicted 610
5 SASI_Mm01_00094047 predicted 299
6 SASI_Mm01_00094048 predicted 302
7 SASI_Mm01_00094049 predicted 460
8 SASI_Mm01_00094050 predicted 632
9 SASI_Mm01_00094051 predicted 328
10 SASI_Mm02_00343047 predicted 634
11 SASI_Mm01_00094042 predicted 338
12 SASI_Mm01_00094044 predicted 403
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145286
STOML3 MISSION shRNA Bacterial Glycerol Stock
stomatin (EPB72)-like 3
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000156155    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145286.1-368s1c1
Sequence:CCGGCCTGCCATGCATAGATGTGTTCTCGAGAACACATCTATGCATGGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145286.1-627s1c1
Sequence:CCGGGCCCATAGCATCCAGACTTTACTCGAGTAAAGTCTGGATGCTATGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145286.1-510s1c1
Sequence:CCGGGCAGTGGCTAATGTCAACGATCTCGAGATCGTTGACATTAGCCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151979    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145286.1-1260s1c1
Sequence:CCGGCGACTTTATAGCAGGAACTTTCTCGAGAAAGTTCCTGCTATAAAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145286.1-962s1c1
Sequence:CCGGCAGCTATGATAACCACAAGAACTCGAGTTCTTGTGGTTATCATAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150761    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145286.1-528s1c1
Sequence:CCGGGATGTCCATCAAGCAACATTTCTCGAGAAATGTTGCTTGATGGACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152154    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145286.1-1801s1c1
Sequence:CCGGCGAGAATGTTTGTGAACTCTACTCGAGTAGAGTTCACAAACATTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432314    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145286.2-1314s21c1
Sequence:CCGGCATTGGGTGACTATGACTAATCTCGAGATTAGTCATAGTCACCCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421285    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145286.2-1218s21c1
Sequence:CCGGTTAGGACCATAATCAACTTTGCTCGAGCAAAGTTGATTATGGTCCTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145286.2-419s21c1
Sequence:CCGGGAACAGTTACTTGCAACATTCCTCGAGGAATGTTGCAAGTAACTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423732    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145286.2-1387s21c1
Sequence:CCGGAGTAACATAGGCCTCATATTTCTCGAGAAATATGAGGCCTATGTTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145286.2-282s21c1
Sequence:CCGGGATGTGCTTGAAGATCATTAACTCGAGTTAATGATCTTCAAGCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145286
STOML3 MISSION shRNA shRNA Plasmid DNA
stomatin (EPB72)-like 3
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000156155    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145286.1-368s1c1
Sequence:CCGGCCTGCCATGCATAGATGTGTTCTCGAGAACACATCTATGCATGGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145286.1-627s1c1
Sequence:CCGGGCCCATAGCATCCAGACTTTACTCGAGTAAAGTCTGGATGCTATGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145286.1-510s1c1
Sequence:CCGGGCAGTGGCTAATGTCAACGATCTCGAGATCGTTGACATTAGCCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151979    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145286.1-1260s1c1
Sequence:CCGGCGACTTTATAGCAGGAACTTTCTCGAGAAAGTTCCTGCTATAAAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145286.1-962s1c1
Sequence:CCGGCAGCTATGATAACCACAAGAACTCGAGTTCTTGTGGTTATCATAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150761    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145286.1-528s1c1
Sequence:CCGGGATGTCCATCAAGCAACATTTCTCGAGAAATGTTGCTTGATGGACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152154    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145286.1-1801s1c1
Sequence:CCGGCGAGAATGTTTGTGAACTCTACTCGAGTAGAGTTCACAAACATTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432314    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145286.2-1314s21c1
Sequence:CCGGCATTGGGTGACTATGACTAATCTCGAGATTAGTCATAGTCACCCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421285    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145286.2-1218s21c1
Sequence:CCGGTTAGGACCATAATCAACTTTGCTCGAGCAAAGTTGATTATGGTCCTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145286.2-419s21c1
Sequence:CCGGGAACAGTTACTTGCAACATTCCTCGAGGAATGTTGCAAGTAACTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423732    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145286.2-1387s21c1
Sequence:CCGGAGTAACATAGGCCTCATATTTCTCGAGAAATATGAGGCCTATGTTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145286.2-282s21c1
Sequence:CCGGGATGTGCTTGAAGATCATTAACTCGAGTTAATGATCTTCAAGCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145286
STOML3 MISSION shRNA Lentiviral Transduction Particles
stomatin (EPB72)-like 3
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000156155    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145286.1-368s1c1
Sequence:CCGGCCTGCCATGCATAGATGTGTTCTCGAGAACACATCTATGCATGGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154978    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145286.1-627s1c1
Sequence:CCGGGCCCATAGCATCCAGACTTTACTCGAGTAAAGTCTGGATGCTATGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145286.1-510s1c1
Sequence:CCGGGCAGTGGCTAATGTCAACGATCTCGAGATCGTTGACATTAGCCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151979    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145286.1-1260s1c1
Sequence:CCGGCGACTTTATAGCAGGAACTTTCTCGAGAAAGTTCCTGCTATAAAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145286.1-962s1c1
Sequence:CCGGCAGCTATGATAACCACAAGAACTCGAGTTCTTGTGGTTATCATAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150761    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145286.1-528s1c1
Sequence:CCGGGATGTCCATCAAGCAACATTTCTCGAGAAATGTTGCTTGATGGACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152154    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145286.1-1801s1c1
Sequence:CCGGCGAGAATGTTTGTGAACTCTACTCGAGTAGAGTTCACAAACATTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432314    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145286.2-1314s21c1
Sequence:CCGGCATTGGGTGACTATGACTAATCTCGAGATTAGTCATAGTCACCCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421285    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145286.2-1218s21c1
Sequence:CCGGTTAGGACCATAATCAACTTTGCTCGAGCAAAGTTGATTATGGTCCTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422421    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145286.2-419s21c1
Sequence:CCGGGAACAGTTACTTGCAACATTCCTCGAGGAATGTTGCAAGTAACTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423732    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145286.2-1387s21c1
Sequence:CCGGAGTAACATAGGCCTCATATTTCTCGAGAAATATGAGGCCTATGTTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145286.2-282s21c1
Sequence:CCGGGATGTGCTTGAAGATCATTAACTCGAGTTAATGATCTTCAAGCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153156
STOML3 MISSION shRNA Bacterial Glycerol Stock
stomatin (EPB72)-like 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000113000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153156.1-268s1c1
Sequence:CCGGCGAACGGTTACTTGTAACATTCTCGAGAATGTTACAAGTAACCGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153156.1-102s1c1
Sequence:CCGGGATGCTCGTTACCTTCCCAATCTCGAGATTGGGAAGGTAACGAGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153156.1-650s1c1
Sequence:CCGGCAGAGGGAGAAATGAATGCTTCTCGAGAAGCATTCATTTCTCCCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153156.1-376s1c1
Sequence:CCGGGTGGCCAATGTGAACGATGTTCTCGAGAACATCGTTCACATTGGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153156.1-244s1c1
Sequence:CCGGGACGTGTTTGTCAAAGTAGATCTCGAGATCTACTTTGACAAACACGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153156
STOML3 MISSION shRNA shRNA Plasmid DNA
stomatin (EPB72)-like 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000113000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153156.1-268s1c1
Sequence:CCGGCGAACGGTTACTTGTAACATTCTCGAGAATGTTACAAGTAACCGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153156.1-102s1c1
Sequence:CCGGGATGCTCGTTACCTTCCCAATCTCGAGATTGGGAAGGTAACGAGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153156.1-650s1c1
Sequence:CCGGCAGAGGGAGAAATGAATGCTTCTCGAGAAGCATTCATTTCTCCCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153156.1-376s1c1
Sequence:CCGGGTGGCCAATGTGAACGATGTTCTCGAGAACATCGTTCACATTGGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153156.1-244s1c1
Sequence:CCGGGACGTGTTTGTCAAAGTAGATCTCGAGATCTACTTTGACAAACACGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153156
STOML3 MISSION shRNA Lentiviral Transduction Particles
stomatin (EPB72)-like 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000113000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153156.1-268s1c1
Sequence:CCGGCGAACGGTTACTTGTAACATTCTCGAGAATGTTACAAGTAACCGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153156.1-102s1c1
Sequence:CCGGGATGCTCGTTACCTTCCCAATCTCGAGATTGGGAAGGTAACGAGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153156.1-650s1c1
Sequence:CCGGCAGAGGGAGAAATGAATGCTTCTCGAGAAGCATTCATTTCTCCCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113004    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153156.1-376s1c1
Sequence:CCGGGTGGCCAATGTGAACGATGTTCTCGAGAACATCGTTCACATTGGCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153156.1-244s1c1
Sequence:CCGGGACGTGTTTGTCAAAGTAGATCTCGAGATCTACTTTGACAAACACGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks