EMAIL THIS PAGE TO A FRIEND

STON1-GTF2A1L

STON1-GTF2A1L readthrough

Synonyms: SALF
Gene ID:
Human(286749) Summary: STON1-GTF2A1L mRNAs are infrequent but naturally occurring read-through products of the neighboring STON1 and GTF2A1L genes. These transcripts encode fusion proteins composed of the vast majority of each of the individual elements, stonin 1 and general transcription factor IIA, 1-like. Alternative splicing results in multiple transcript variants. The significance of these read-through variants and the function of the resulting protein products have not yet been determined. [provided by RefSeq, Oct 2010]
185 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172311 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_172311 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_172311 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_172311 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172311 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00110711 predicted 3185
2 SASI_Hs01_00110712 predicted 2450
3 SASI_Hs01_00110714 predicted 2756
4 SASI_Hs01_00110715 predicted 2674
5 SASI_Hs02_00367967 predicted 3096
6 SASI_Hs01_00110716 predicted 2607
7 SASI_Hs01_00110717 predicted 2450
8 SASI_Hs01_00110718 predicted 2975
9 SASI_Hs01_00110719 predicted 2489
10 SASI_Hs01_00110720 predicted 2937
11 SASI_Hs01_00110713 predicted 2937
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172311
STON1-GTF2A1L MISSION shRNA Bacterial Glycerol Stock
STON1-GTF2A1L readthrough
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000018012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172311.1-774s1c1
Sequence:CCGGCCTAAATAAGTGTTCACTCAACTCGAGTTGAGTGAACACTTATTTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172311.1-2233s1c1
Sequence:CCGGTGCTACAACATCCAGCCTAAACTCGAGTTTAGGCTGGATGTTGTAGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172311.1-337s1c1
Sequence:CCGGCCTCCAAGTAACTCTCCTCTTCTCGAGAAGAGGAGAGTTACTTGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172311.1-3562s1c1
Sequence:CCGGCGAAGCAAGAACAAATGGAAACTCGAGTTTCCATTTGTTCTTGCTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172311.1-1659s1c1
Sequence:CCGGGCGTTTCAAGACTTTGTATAACTCGAGTTATACAAAGTCTTGAAACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172311.1-3511s21c1
Sequence:CCGGGACCTGTTTGACACGGATAATCTCGAGATTATCCGTGTCAAACAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172311.1-443s21c1
Sequence:CCGGCAGACAGCCCACTCGCAATATCTCGAGATATTGCGAGTGGGCTGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172311.1-1076s21c1
Sequence:CCGGAGATACAGCTTGATCCATATTCTCGAGAATATGGATCAAGCTGTATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172311.1-2683s21c1
Sequence:CCGGCATCCAATTCAGCAAGTATTTCTCGAGAAATACTTGCTGAATTGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172311
STON1-GTF2A1L MISSION shRNA shRNA Plasmid DNA
STON1-GTF2A1L readthrough
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000018012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172311.1-774s1c1
Sequence:CCGGCCTAAATAAGTGTTCACTCAACTCGAGTTGAGTGAACACTTATTTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172311.1-2233s1c1
Sequence:CCGGTGCTACAACATCCAGCCTAAACTCGAGTTTAGGCTGGATGTTGTAGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172311.1-337s1c1
Sequence:CCGGCCTCCAAGTAACTCTCCTCTTCTCGAGAAGAGGAGAGTTACTTGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172311.1-3562s1c1
Sequence:CCGGCGAAGCAAGAACAAATGGAAACTCGAGTTTCCATTTGTTCTTGCTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172311.1-1659s1c1
Sequence:CCGGGCGTTTCAAGACTTTGTATAACTCGAGTTATACAAAGTCTTGAAACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172311.1-3511s21c1
Sequence:CCGGGACCTGTTTGACACGGATAATCTCGAGATTATCCGTGTCAAACAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172311.1-443s21c1
Sequence:CCGGCAGACAGCCCACTCGCAATATCTCGAGATATTGCGAGTGGGCTGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172311.1-1076s21c1
Sequence:CCGGAGATACAGCTTGATCCATATTCTCGAGAATATGGATCAAGCTGTATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172311.1-2683s21c1
Sequence:CCGGCATCCAATTCAGCAAGTATTTCTCGAGAAATACTTGCTGAATTGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172311
STON1-GTF2A1L MISSION shRNA Lentiviral Transduction Particles
STON1-GTF2A1L readthrough
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000018012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172311.1-774s1c1
Sequence:CCGGCCTAAATAAGTGTTCACTCAACTCGAGTTGAGTGAACACTTATTTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172311.1-2233s1c1
Sequence:CCGGTGCTACAACATCCAGCCTAAACTCGAGTTTAGGCTGGATGTTGTAGCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172311.1-337s1c1
Sequence:CCGGCCTCCAAGTAACTCTCCTCTTCTCGAGAAGAGGAGAGTTACTTGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172311.1-3562s1c1
Sequence:CCGGCGAAGCAAGAACAAATGGAAACTCGAGTTTCCATTTGTTCTTGCTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172311.1-1659s1c1
Sequence:CCGGGCGTTTCAAGACTTTGTATAACTCGAGTTATACAAAGTCTTGAAACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427465    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172311.1-3511s21c1
Sequence:CCGGGACCTGTTTGACACGGATAATCTCGAGATTATCCGTGTCAAACAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426677    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172311.1-443s21c1
Sequence:CCGGCAGACAGCCCACTCGCAATATCTCGAGATATTGCGAGTGGGCTGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421888    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172311.1-1076s21c1
Sequence:CCGGAGATACAGCTTGATCCATATTCTCGAGAATATGGATCAAGCTGTATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172311.1-2683s21c1
Sequence:CCGGCATCCAATTCAGCAAGTATTTCTCGAGAAATACTTGCTGAATTGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks