EMAIL THIS PAGE TO A FRIEND

STON1

stonin 1

Synonyms: SALF SBLF STN1 STNB1
UniProtKB ID: Q9Y6Q2, A8MXJ1, B5MCF5, B7ZL16, Q96JE3, Q9BYX3
Gene ID:
Human(11037) Summary: Endocytosis of cell surface proteins is mediated by a complex molecular machinery that assembles on the inner surface of the plasma membrane. This gene encodes one of two human homologs of the Drosophila melanogaster stoned B protein. This protein is related to components of the endocytic machinery and exhibits a modular structure consisting of an N-terminal proline-rich domain, a central region of homology specific to the human stoned B-like proteins, and a C-terminal region homologous to the mu subunits of adaptor protein (AP) complexes. Read-through transcription of this gene into the neighboring downstream gene, which encodes TFIIA-alpha/beta-like factor, generates a transcript (SALF), which encodes a fusion protein comprised of sequence sharing identity with each individual gene product. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2010]
Mouse(77057) stonin 1
Rat(360202) stonin 1
Horse(100534008) stonin 1
dog(100534006) stonin 1
cow(100140704) stonin 1
67 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006873 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006873 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006873 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029858 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029858 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029858 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU213671 MISSION® esiRNA esiRNA targeting mouse Ston1 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006873 Rosetta Predictions human pricing
XM_575989 Rosetta Predictions rat pricing
NM_029858 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006873 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00097104 predicted 1760
2 SASI_Hs01_00097106 predicted 457
3 SASI_Hs01_00097107 predicted 300
4 SASI_Hs01_00097108 predicted 1402
5 SASI_Hs01_00097109 predicted 694
6 SASI_Hs01_00097111 predicted 1497
7 SASI_Hs01_00097112 predicted 637
8 SASI_Hs01_00097113 predicted 1196
9 SASI_Hs02_00342513 predicted 1620
10 SASI_Hs02_00342514 predicted 665
11 SASI_Hs01_00097105 predicted 1245
12 SASI_Hs01_00097110 predicted 992
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_575989 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00178629 predicted 706
2 SASI_Rn01_00178630 predicted 669
3 SASI_Rn01_00178631 predicted 747
4 SASI_Rn01_00178632 predicted 711
5 SASI_Rn01_00178633 predicted 641
6 SASI_Rn01_00178634 predicted 646
7 SASI_Rn01_00178635 predicted 835
8 SASI_Rn01_00178636 predicted 919
9 SASI_Rn01_00178637 predicted 674
10 SASI_Rn01_00178638 predicted 842
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029858 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00336080 predicted 2324
2 SASI_Mm02_00336081 predicted 2455
3 SASI_Mm02_00336082 predicted 1486
4 SASI_Mm02_00336083 predicted 1246
5 SASI_Mm02_00336084 predicted 2027
6 SASI_Mm02_00336085 predicted 379
7 SASI_Mm02_00336086 predicted 2145
8 SASI_Mm02_00336087 predicted 1401
9 SASI_Mm02_00336088 predicted 1789
10 SASI_Mm02_00336089 predicted 2333
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006873
VALIDATED
STON1 MISSION shRNA Bacterial Glycerol Stock
stonin 1
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000204738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_006873.2-725s1c1
Sequence:CCGGGCTGAGAACCAAGACTCACTTCTCGAGAAGTGAGTCTTGGTTCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000204320    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_006873.2-1400s1c1
Sequence:CCGGCCGAAGCGAGATGAATCCTATCTCGAGATAGGATTCATCTCGCTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000203795    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006873.2-1401s1c1
Sequence:CCGGCGAAGCGAGATGAATCCTATTCTCGAGAATAGGATTCATCTCGCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000186696    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006873.2-1552s1c1
Sequence:CCGGGATGCGTTTCAAGACTTTGTACTCGAGTACAAAGTCTTGAAACGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000188076    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_006873.2-2000s1c1
Sequence:CCGGCCCTCTGATTGGTATCCATTTCTCGAGAAATGGATACCAATCAGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_006873.2-1898s1c2
Sequence:CCGGGCAGTGGTATGGAAGATAGATCTCGAGATCTATCTTCCATACCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006873
VALIDATED
STON1 MISSION shRNA shRNA Plasmid DNA
stonin 1
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000204738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_006873.2-725s1c1
Sequence:CCGGGCTGAGAACCAAGACTCACTTCTCGAGAAGTGAGTCTTGGTTCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000204320    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_006873.2-1400s1c1
Sequence:CCGGCCGAAGCGAGATGAATCCTATCTCGAGATAGGATTCATCTCGCTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000203795    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006873.2-1401s1c1
Sequence:CCGGCGAAGCGAGATGAATCCTATTCTCGAGAATAGGATTCATCTCGCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000186696    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006873.2-1552s1c1
Sequence:CCGGGATGCGTTTCAAGACTTTGTACTCGAGTACAAAGTCTTGAAACGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000188076    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_006873.2-2000s1c1
Sequence:CCGGCCCTCTGATTGGTATCCATTTCTCGAGAAATGGATACCAATCAGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_006873.2-1898s1c2
Sequence:CCGGGCAGTGGTATGGAAGATAGATCTCGAGATCTATCTTCCATACCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006873
VALIDATED
STON1 MISSION shRNA Lentiviral Transduction Particles
stonin 1
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000204738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_006873.2-725s1c1
Sequence:CCGGGCTGAGAACCAAGACTCACTTCTCGAGAAGTGAGTCTTGGTTCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000204320    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_006873.2-1400s1c1
Sequence:CCGGCCGAAGCGAGATGAATCCTATCTCGAGATAGGATTCATCTCGCTTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000203795    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006873.2-1401s1c1
Sequence:CCGGCGAAGCGAGATGAATCCTATTCTCGAGAATAGGATTCATCTCGCTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000186696    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006873.2-1552s1c1
Sequence:CCGGGATGCGTTTCAAGACTTTGTACTCGAGTACAAAGTCTTGAAACGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000188076    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_006873.2-2000s1c1
Sequence:CCGGCCCTCTGATTGGTATCCATTTCTCGAGAAATGGATACCAATCAGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194286    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_006873.2-1898s1c2
Sequence:CCGGGCAGTGGTATGGAAGATAGATCTCGAGATCTATCTTCCATACCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029858
STON1 MISSION shRNA Bacterial Glycerol Stock
stonin 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000111903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029858.1-1811s1c1
Sequence:CCGGACAGTCCAGAATCATTAAGTTCTCGAGAACTTAATGATTCTGGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111900    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029858.1-2934s1c1
Sequence:CCGGCCCTGGAGACTAGCTTTCATACTCGAGTATGAAAGCTAGTCTCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029858.1-1674s1c1
Sequence:CCGGGCGGAATGTTTCTTAGCCTTACTCGAGTAAGGCTAAGAAACATTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029858.1-2441s1c1
Sequence:CCGGCTACAACATCCAGGTTGAAATCTCGAGATTTCAACCTGGATGTTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029858.1-1163s1c1
Sequence:CCGGTCCCGTGAAGAAGAACATGATCTCGAGATCATGTTCTTCTTCACGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029858
STON1 MISSION shRNA shRNA Plasmid DNA
stonin 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000111903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029858.1-1811s1c1
Sequence:CCGGACAGTCCAGAATCATTAAGTTCTCGAGAACTTAATGATTCTGGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111900    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029858.1-2934s1c1
Sequence:CCGGCCCTGGAGACTAGCTTTCATACTCGAGTATGAAAGCTAGTCTCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029858.1-1674s1c1
Sequence:CCGGGCGGAATGTTTCTTAGCCTTACTCGAGTAAGGCTAAGAAACATTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029858.1-2441s1c1
Sequence:CCGGCTACAACATCCAGGTTGAAATCTCGAGATTTCAACCTGGATGTTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029858.1-1163s1c1
Sequence:CCGGTCCCGTGAAGAAGAACATGATCTCGAGATCATGTTCTTCTTCACGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029858
STON1 MISSION shRNA Lentiviral Transduction Particles
stonin 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000111903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029858.1-1811s1c1
Sequence:CCGGACAGTCCAGAATCATTAAGTTCTCGAGAACTTAATGATTCTGGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111900    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029858.1-2934s1c1
Sequence:CCGGCCCTGGAGACTAGCTTTCATACTCGAGTATGAAAGCTAGTCTCCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029858.1-1674s1c1
Sequence:CCGGGCGGAATGTTTCTTAGCCTTACTCGAGTAAGGCTAAGAAACATTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029858.1-2441s1c1
Sequence:CCGGCTACAACATCCAGGTTGAAATCTCGAGATTTCAACCTGGATGTTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029858.1-1163s1c1
Sequence:CCGGTCCCGTGAAGAAGAACATGATCTCGAGATCATGTTCTTCTTCACGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks