EMAIL THIS PAGE TO A FRIEND

STON2

stonin 2

Synonyms: STN2 STNB STNB2
Gene ID:
Human(85439) Summary: This gene encodes a protein which is a membrane protein involved in regulating endocytotic complexes. The protein product is described as one of the clathrin-associated sorting proteins, adaptor molecules which ensure specific proteins are internalized. The encoded protein has also been shown to participate in synaptic vesicle recycling through interaction with synaptotagmin 1 required for neurotransmission. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
Mouse(108800) stonin 2
Rat(314349) stonin 2
Horse(100052660) stonin 2
dog(490815) stonin 2
chicken(423390) stonin 2
cow(785664) stonin 2
sheep(101117080) stonin 2
96 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA003086 Anti-STON2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175367 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175367 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175367 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_033104 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033104 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033104 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU010421 MISSION® esiRNA esiRNA targeting human STON2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033104 Rosetta Predictions human pricing
XM_001061069 Rosetta Predictions rat pricing
XM_234454 Rosetta Predictions rat pricing
NM_175367 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033104 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00114072 predicted 2205
2 SASI_Hs01_00114073 predicted 1699
3 SASI_Hs02_00360809 predicted 1144
4 SASI_Hs01_00114074 predicted 1570
5 SASI_Hs01_00114075 predicted 990
6 SASI_Hs01_00114077 predicted 2545
7 SASI_Hs02_00360810 predicted 2208
8 SASI_Hs01_00114080 predicted 2566
9 SASI_Hs02_00360811 predicted 1956
10 SASI_Hs02_00360812 predicted 1667
11 SASI_Hs01_00114076 predicted 1817
12 SASI_Hs01_00114078 predicted 1910
13 SASI_Hs01_00114079 predicted 1265
14 SASI_Hs01_00114081 predicted 1355
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001061069 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00298690 predicted 1167
2 SASI_Rn02_00298691 predicted 1863
3 SASI_Rn02_00298692 predicted 810
4 SASI_Rn02_00298693 predicted 2681
5 SASI_Rn02_00298694 predicted 1785
6 SASI_Rn02_00298695 predicted 1910
7 SASI_Rn02_00298696 predicted 2454
8 SASI_Rn02_00298697 predicted 950
9 SASI_Rn02_00298698 predicted 2588
10 SASI_Rn02_00298699 predicted 1462
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_234454 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00388489 predicted 1174
2 SASI_Rn02_00388490 predicted 1213
3 SASI_Rn02_00388491 predicted 1178
4 SASI_Rn02_00388492 predicted 814
5 SASI_Rn02_00388493 predicted 905
6 SASI_Rn02_00388494 predicted 950
7 SASI_Rn02_00388495 predicted 594
8 SASI_Rn02_00388496 predicted 1261
9 SASI_Rn02_00388497 predicted 209
10 SASI_Rn02_00388498 predicted 709
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175367 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00042794 predicted 2965
2 SASI_Mm01_00042795 predicted 1848
3 SASI_Mm01_00042796 predicted 1272
4 SASI_Mm01_00042797 predicted 2279
5 SASI_Mm01_00042798 predicted 1328
6 SASI_Mm01_00042799 predicted 1282
7 SASI_Mm01_00042800 predicted 1328
8 SASI_Mm01_00042801 predicted 2236
9 SASI_Mm01_00042802 predicted 1820
10 SASI_Mm01_00042803 predicted 1867
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175367
STON2 MISSION shRNA Bacterial Glycerol Stock
stonin 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000111915    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175367.2-4077s1c1
Sequence:CCGGCCTCAGATACAATGACTGTTACTCGAGTAACAGTCATTGTATCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175367.2-1330s1c1
Sequence:CCGGCACACTGATGAACTTACCCAACTCGAGTTGGGTAAGTTCATCAGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175367.2-1485s1c1
Sequence:CCGGCTTTCTTTGAAGAGCAGGAAACTCGAGTTTCCTGCTCTTCAAAGAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175367.2-3058s1c1
Sequence:CCGGCGTCAGGAAGTGGGTCAATTACTCGAGTAATTGACCCACTTCCTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000111916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175367.2-2957s1c1
Sequence:CCGGCCTTCCAGATTTGCCAACTATCTCGAGATAGTTGGCAAATCTGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175367
STON2 MISSION shRNA shRNA Plasmid DNA
stonin 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000111915    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175367.2-4077s1c1
Sequence:CCGGCCTCAGATACAATGACTGTTACTCGAGTAACAGTCATTGTATCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175367.2-1330s1c1
Sequence:CCGGCACACTGATGAACTTACCCAACTCGAGTTGGGTAAGTTCATCAGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175367.2-1485s1c1
Sequence:CCGGCTTTCTTTGAAGAGCAGGAAACTCGAGTTTCCTGCTCTTCAAAGAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175367.2-3058s1c1
Sequence:CCGGCGTCAGGAAGTGGGTCAATTACTCGAGTAATTGACCCACTTCCTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000111916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175367.2-2957s1c1
Sequence:CCGGCCTTCCAGATTTGCCAACTATCTCGAGATAGTTGGCAAATCTGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175367
STON2 MISSION shRNA Lentiviral Transduction Particles
stonin 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000111915    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175367.2-4077s1c1
Sequence:CCGGCCTCAGATACAATGACTGTTACTCGAGTAACAGTCATTGTATCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175367.2-1330s1c1
Sequence:CCGGCACACTGATGAACTTACCCAACTCGAGTTGGGTAAGTTCATCAGTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175367.2-1485s1c1
Sequence:CCGGCTTTCTTTGAAGAGCAGGAAACTCGAGTTTCCTGCTCTTCAAAGAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175367.2-3058s1c1
Sequence:CCGGCGTCAGGAAGTGGGTCAATTACTCGAGTAATTGACCCACTTCCTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000111916    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175367.2-2957s1c1
Sequence:CCGGCCTTCCAGATTTGCCAACTATCTCGAGATAGTTGGCAAATCTGGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033104
VALIDATED
STON2 MISSION shRNA Bacterial Glycerol Stock
stonin 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000065253    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_033104.2-1857s1c1
Sequence:CCGGGCCAGTGTTGTCAATGGACTTCTCGAGAAGTCCATTGACAACACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033104.2-2055s1c1
Sequence:CCGGCCTCGTCAAAGGGAATGAAATCTCGAGATTTCATTCCCTTTGACGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033104.2-976s1c1
Sequence:CCGGGCATCTGTGATCCCAGATGTACTCGAGTACATCTGGGATCACAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033104.2-1074s1c1
Sequence:CCGGGCTGGATATTTCCTCTTTAAACTCGAGTTTAAAGAGGAAATATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_033104.2-685s1c1
Sequence:CCGGCCTAGCTTTGGATGTTCGTATCTCGAGATACGAACATCCAAAGCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033104
VALIDATED
STON2 MISSION shRNA shRNA Plasmid DNA
stonin 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000065253    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_033104.2-1857s1c1
Sequence:CCGGGCCAGTGTTGTCAATGGACTTCTCGAGAAGTCCATTGACAACACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033104.2-2055s1c1
Sequence:CCGGCCTCGTCAAAGGGAATGAAATCTCGAGATTTCATTCCCTTTGACGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033104.2-976s1c1
Sequence:CCGGGCATCTGTGATCCCAGATGTACTCGAGTACATCTGGGATCACAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033104.2-1074s1c1
Sequence:CCGGGCTGGATATTTCCTCTTTAAACTCGAGTTTAAAGAGGAAATATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_033104.2-685s1c1
Sequence:CCGGCCTAGCTTTGGATGTTCGTATCTCGAGATACGAACATCCAAAGCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033104
VALIDATED
STON2 MISSION shRNA Lentiviral Transduction Particles
stonin 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000065253    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_033104.2-1857s1c1
Sequence:CCGGGCCAGTGTTGTCAATGGACTTCTCGAGAAGTCCATTGACAACACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065255    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033104.2-2055s1c1
Sequence:CCGGCCTCGTCAAAGGGAATGAAATCTCGAGATTTCATTCCCTTTGACGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065256    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033104.2-976s1c1
Sequence:CCGGGCATCTGTGATCCCAGATGTACTCGAGTACATCTGGGATCACAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065254    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033104.2-1074s1c1
Sequence:CCGGGCTGGATATTTCCTCTTTAAACTCGAGTTTAAAGAGGAAATATCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065257    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_033104.2-685s1c1
Sequence:CCGGCCTAGCTTTGGATGTTCGTATCTCGAGATACGAACATCCAAAGCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks