EMAIL THIS PAGE TO A FRIEND

STOX1

storkhead box 1

Synonyms: C10orf24 PEE4
Gene ID:
Human(219736) Summary: The protein encoded by this gene may function as a DNA binding protein. Mutations in this gene are associated with pre-eclampsia/eclampsia 4 (PEE4). Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009]
Mouse(216021) storkhead box 1
Rat(294388) storkhead box 1
Zebrafish(568146) storkhead box 1
Horse(100072657) storkhead box 1
domestic cat(101098165) storkhead box 1
dog(489017) storkhead box 1
chicken(100858074) storkhead box 1
cow(506979) storkhead box 1
sheep(101103781) storkhead box 1
naked mole-rat(101704188) storkhead box 1
Domestic Rabbit(100346651) storkhead box 1
84 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152709 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152709 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152709 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001033260 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033260 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033260 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU065821 MISSION® esiRNA esiRNA human STOX1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152709 Rosetta Predictions human pricing
XM_001057100 Rosetta Predictions rat pricing
XM_228160 Rosetta Predictions rat pricing
XM_125685 Rosetta Predictions mouse pricing
XM_905594 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152709 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00366605 predicted 1780
2 SASI_Hs01_00102570 predicted 1194
3 SASI_Hs01_00102571 predicted 938
4 SASI_Hs01_00102572 predicted 2612
5 SASI_Hs01_00102573 predicted 2832
6 SASI_Hs01_00102575 predicted 1644
7 SASI_Hs02_00366606 predicted 2065
8 SASI_Hs02_00366607 predicted 1836
9 SASI_Hs01_00102578 predicted 2498
10 SASI_Hs01_00102579 predicted 2313
11 SASI_Hs01_00102574 predicted 1422
12 SASI_Hs01_00102576 predicted 2793
13 SASI_Hs01_00102577 predicted 1076
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001057100 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00285409 predicted 2599
2 SASI_Rn02_00285410 predicted 2024
3 SASI_Rn02_00285411 predicted 433
4 SASI_Rn02_00285412 predicted 2474
5 SASI_Rn02_00285413 predicted 339
6 SASI_Rn02_00285414 predicted 1428
7 SASI_Rn02_00285415 predicted 785
8 SASI_Rn02_00285416 predicted 1944
9 SASI_Rn02_00285417 predicted 577
10 SASI_Rn02_00285418 predicted 1525
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_228160 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00384956 predicted 2602
2 SASI_Rn02_00384957 predicted 414
3 SASI_Rn02_00384958 predicted 437
4 SASI_Rn02_00384959 predicted 2469
5 SASI_Rn02_00384960 predicted 340
6 SASI_Rn02_00384961 predicted 1432
7 SASI_Rn02_00384962 predicted 790
8 SASI_Rn02_00384963 predicted 575
9 SASI_Rn02_00384964 predicted 1521
10 SASI_Rn02_00384965 predicted 2545
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_125685 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00424103 predicted 2255
2 SASI_Mm02_00424104 predicted 2443
3 SASI_Mm02_00424105 predicted 2381
4 SASI_Mm01_00229522 predicted 2627
5 SASI_Mm02_00424106 predicted 2513
6 SASI_Mm02_00424107 predicted 2388
7 SASI_Mm02_00424108 predicted 2279
8 SASI_Mm02_00424109 predicted 2498
9 SASI_Mm02_00424110 predicted 2700
10 SASI_Mm02_00424111 predicted 2506
11 SASI_Mm01_00229521 predicted 2116
12 SASI_Mm01_00229523 predicted 2125
13 SASI_Mm01_00229524 predicted 2749
14 SASI_Mm01_00229525 predicted 2097
15 SASI_Mm01_00229526 predicted 1327
16 SASI_Mm01_00229527 predicted 2023
17 SASI_Mm01_00229528 predicted 2043
18 SASI_Mm01_00229529 predicted 1454
19 SASI_Mm01_00229530 predicted 892
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_905594 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00431890 predicted 1798
2 SASI_Mm02_00431891 predicted 389
3 SASI_Mm02_00431892 predicted 2327
4 SASI_Mm02_00431893 predicted 482
5 SASI_Mm02_00431894 predicted 1068
6 SASI_Mm02_00431895 predicted 1816
7 SASI_Mm02_00431896 predicted 2437
8 SASI_Mm02_00431897 predicted 1783
9 SASI_Mm02_00431898 predicted 1011
10 SASI_Mm02_00431899 predicted 1708
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152709
STOX1 MISSION shRNA Bacterial Glycerol Stock
storkhead box 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000155627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152709.2-634s1c1
Sequence:CCGGCCGAGGAAGCACAATATCCAACTCGAGTTGGATATTGTGCTTCCTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152709.2-1465s1c1
Sequence:CCGGGACCGAGTACAACAGCACAATCTCGAGATTGTGCTGTTGTACTCGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152709.2-2040s1c1
Sequence:CCGGGCAGTCAACCACTCACATCTACTCGAGTAGATGTGAGTGGTTGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155264    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152709.2-444s1c1
Sequence:CCGGGAAGTGAGTTTCAGCCAGGAACTCGAGTTCCTGGCTGAAACTCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152709.2-776s1c1
Sequence:CCGGCCATATGCTGAACAACCTAATCTCGAGATTAGGTTGTTCAGCATATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152262    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152709.2-1923s1c1
Sequence:CCGGCAGGAGATAGTGGAATAGATTCTCGAGAATCTATTCCACTATCTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152709.2-1583s1c1
Sequence:CCGGGCTGAAAGTTGTGGCCTAAATCTCGAGATTTAGGCCACAACTTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152820    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152709.2-1786s1c1
Sequence:CCGGGAGTCCTCAGAATCAGGAAATCTCGAGATTTCCTGATTCTGAGGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153192    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152709.2-1236s1c1
Sequence:CCGGCAGAGACTACAAGCCTAGAAACTCGAGTTTCTAGGCTTGTAGTCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155320    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152709.2-325s1c1
Sequence:CCGGGCTGACAATCGGGCATAAGTACTCGAGTACTTATGCCCGATTGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152709
STOX1 MISSION shRNA shRNA Plasmid DNA
storkhead box 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000155627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152709.2-634s1c1
Sequence:CCGGCCGAGGAAGCACAATATCCAACTCGAGTTGGATATTGTGCTTCCTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152709.2-1465s1c1
Sequence:CCGGGACCGAGTACAACAGCACAATCTCGAGATTGTGCTGTTGTACTCGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152709.2-2040s1c1
Sequence:CCGGGCAGTCAACCACTCACATCTACTCGAGTAGATGTGAGTGGTTGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155264    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152709.2-444s1c1
Sequence:CCGGGAAGTGAGTTTCAGCCAGGAACTCGAGTTCCTGGCTGAAACTCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152709.2-776s1c1
Sequence:CCGGCCATATGCTGAACAACCTAATCTCGAGATTAGGTTGTTCAGCATATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152262    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152709.2-1923s1c1
Sequence:CCGGCAGGAGATAGTGGAATAGATTCTCGAGAATCTATTCCACTATCTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152709.2-1583s1c1
Sequence:CCGGGCTGAAAGTTGTGGCCTAAATCTCGAGATTTAGGCCACAACTTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152820    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152709.2-1786s1c1
Sequence:CCGGGAGTCCTCAGAATCAGGAAATCTCGAGATTTCCTGATTCTGAGGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153192    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152709.2-1236s1c1
Sequence:CCGGCAGAGACTACAAGCCTAGAAACTCGAGTTTCTAGGCTTGTAGTCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155320    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152709.2-325s1c1
Sequence:CCGGGCTGACAATCGGGCATAAGTACTCGAGTACTTATGCCCGATTGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152709
STOX1 MISSION shRNA Lentiviral Transduction Particles
storkhead box 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000155627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152709.2-634s1c1
Sequence:CCGGCCGAGGAAGCACAATATCCAACTCGAGTTGGATATTGTGCTTCCTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152709.2-1465s1c1
Sequence:CCGGGACCGAGTACAACAGCACAATCTCGAGATTGTGCTGTTGTACTCGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154784    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152709.2-2040s1c1
Sequence:CCGGGCAGTCAACCACTCACATCTACTCGAGTAGATGTGAGTGGTTGACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155264    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152709.2-444s1c1
Sequence:CCGGGAAGTGAGTTTCAGCCAGGAACTCGAGTTCCTGGCTGAAACTCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151817    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152709.2-776s1c1
Sequence:CCGGCCATATGCTGAACAACCTAATCTCGAGATTAGGTTGTTCAGCATATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152262    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152709.2-1923s1c1
Sequence:CCGGCAGGAGATAGTGGAATAGATTCTCGAGAATCTATTCCACTATCTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152709.2-1583s1c1
Sequence:CCGGGCTGAAAGTTGTGGCCTAAATCTCGAGATTTAGGCCACAACTTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152820    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152709.2-1786s1c1
Sequence:CCGGGAGTCCTCAGAATCAGGAAATCTCGAGATTTCCTGATTCTGAGGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153192    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152709.2-1236s1c1
Sequence:CCGGCAGAGACTACAAGCCTAGAAACTCGAGTTTCTAGGCTTGTAGTCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155320    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152709.2-325s1c1
Sequence:CCGGGCTGACAATCGGGCATAAGTACTCGAGTACTTATGCCCGATTGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033260
STOX1 MISSION shRNA Bacterial Glycerol Stock
storkhead box 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000252639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033260.1-2862s21c1
Sequence:CCGGAGAGCCTGGTATCTACTAATTCTCGAGAATTAGTAGATACCAGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033260.1-1673s21c1
Sequence:CCGGCCGGAACAATGCCGTGATAAACTCGAGTTTATCACGGCATTGTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033260.1-1082s21c1
Sequence:CCGGGATGTGGAACATGCGCTAATCCTCGAGGATTAGCGCATGTTCCACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033260.1-1466s21c1
Sequence:CCGGCTAGGCTCCCACTTGATATATCTCGAGATATATCAAGTGGGAGCCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033260.1-1232s21c1
Sequence:CCGGGATTCCTCTAAAGAGGTAATTCTCGAGAATTACCTCTTTAGAGGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033260
STOX1 MISSION shRNA shRNA Plasmid DNA
storkhead box 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000252639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033260.1-2862s21c1
Sequence:CCGGAGAGCCTGGTATCTACTAATTCTCGAGAATTAGTAGATACCAGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033260.1-1673s21c1
Sequence:CCGGCCGGAACAATGCCGTGATAAACTCGAGTTTATCACGGCATTGTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033260.1-1082s21c1
Sequence:CCGGGATGTGGAACATGCGCTAATCCTCGAGGATTAGCGCATGTTCCACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033260.1-1466s21c1
Sequence:CCGGCTAGGCTCCCACTTGATATATCTCGAGATATATCAAGTGGGAGCCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033260.1-1232s21c1
Sequence:CCGGGATTCCTCTAAAGAGGTAATTCTCGAGAATTACCTCTTTAGAGGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033260
STOX1 MISSION shRNA Lentiviral Transduction Particles
storkhead box 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000252639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033260.1-2862s21c1
Sequence:CCGGAGAGCCTGGTATCTACTAATTCTCGAGAATTAGTAGATACCAGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033260.1-1673s21c1
Sequence:CCGGCCGGAACAATGCCGTGATAAACTCGAGTTTATCACGGCATTGTTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252642    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033260.1-1082s21c1
Sequence:CCGGGATGTGGAACATGCGCTAATCCTCGAGGATTAGCGCATGTTCCACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033260.1-1466s21c1
Sequence:CCGGCTAGGCTCCCACTTGATATATCTCGAGATATATCAAGTGGGAGCCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252641    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033260.1-1232s21c1
Sequence:CCGGGATTCCTCTAAAGAGGTAATTCTCGAGAATTACCTCTTTAGAGGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks