EMAIL THIS PAGE TO A FRIEND

STOX2

storkhead box 2

UniProtKB ID: Q9P2F5, A6H8U4, Q9NPS8
Gene ID:
Mouse(71069) storkhead box 2
Rat(306459) storkhead box 2
naked mole-rat(101699473) storkhead box 2
cow(535434) storkhead box 2
sheep(101108452) storkhead box 2
chicken(769288) storkhead box 2
Horse(100051063) storkhead box 2
domestic cat(101089095) storkhead box 2
dog(482912) storkhead box 2
135 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020225 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020225 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020225 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175162 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175162 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175162 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020225 Rosetta Predictions human pricing
NM_001134863 Rosetta Predictions rat pricing
XM_001055554 Rosetta Predictions rat pricing
XM_001055729 Rosetta Predictions rat pricing
XM_001055901 Rosetta Predictions rat pricing
NM_001114311 Rosetta Predictions mouse pricing
NM_175162 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020225 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00117908 predicted 3624
2 SASI_Hs01_00117909 predicted 2264
3 SASI_Hs01_00117910 predicted 1682
4 SASI_Hs01_00117911 predicted 2236
5 SASI_Hs01_00117912 predicted 1610
6 SASI_Hs01_00117913 predicted 2374
7 SASI_Hs01_00117915 predicted 2169
8 SASI_Hs02_00353166 predicted 2610
9 SASI_Hs01_00117917 predicted 3741
10 SASI_Hs02_00353167 predicted 4035
11 SASI_Hs01_00117914 predicted 2367
12 SASI_Hs01_00117916 predicted 1883
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134863 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00258834 predicted 2190
2 SASI_Rn02_00258835 predicted 2910
3 SASI_Rn02_00258836 predicted 3740
4 SASI_Rn02_00258837 predicted 1599
5 SASI_Rn02_00258838 predicted 2082
6 SASI_Rn02_00258839 predicted 2204
7 SASI_Rn02_00258840 predicted 2287
8 SASI_Rn02_00258841 predicted 2962
9 SASI_Rn02_00258842 predicted 3965
10 SASI_Rn02_00258843 predicted 2153
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001055554 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00279994 predicted 802
2 SASI_Rn02_00279995 predicted 2048
3 SASI_Rn02_00279996 predicted 1518
4 SASI_Rn02_00279997 predicted 2070
5 SASI_Rn02_00279998 predicted 684
6 SASI_Rn02_00279999 predicted 807
7 SASI_Rn02_00280000 predicted 800
8 SASI_Rn02_00280001 predicted 899
9 SASI_Rn02_00280002 predicted 1563
10 SASI_Rn02_00280003 predicted 759
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001055729 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00280790 predicted 799
2 SASI_Rn02_00280791 predicted 1524
3 SASI_Rn02_00280792 predicted 2349
4 SASI_Rn02_00280793 predicted 680
5 SASI_Rn02_00280794 predicted 805
6 SASI_Rn02_00280795 predicted 793
7 SASI_Rn02_00280796 predicted 896
8 SASI_Rn02_00280797 predicted 1567
9 SASI_Rn02_00280798 predicted 2573
10 SASI_Rn02_00280799 predicted 762
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001055901 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00281338 predicted 2187
2 SASI_Rn02_00281339 predicted 2912
3 SASI_Rn02_00281340 predicted 3744
4 SASI_Rn02_00281341 predicted 1601
5 SASI_Rn02_00281342 predicted 2075
6 SASI_Rn02_00281343 predicted 2207
7 SASI_Rn02_00281344 predicted 2291
8 SASI_Rn02_00281345 predicted 2959
9 SASI_Rn02_00281346 predicted 3966
10 SASI_Rn02_00281347 predicted 2151
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001114311 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00308490 predicted 1803
2 SASI_Mm02_00308491 predicted 2187
3 SASI_Mm02_00308492 predicted 2076
4 SASI_Mm02_00308493 predicted 2206
5 SASI_Mm02_00308494 predicted 2149
6 SASI_Mm02_00308495 predicted 2913
7 SASI_Mm02_00308496 predicted 2982
8 SASI_Mm02_00308497 predicted 2958
9 SASI_Mm02_00308498 predicted 2966
10 SASI_Mm02_00308499 predicted 2825
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175162 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00075361 predicted 591
2 SASI_Mm01_00075362 predicted 985
3 SASI_Mm01_00075363 predicted 873
4 SASI_Mm02_00345797 predicted 999
5 SASI_Mm01_00075364 predicted 951
6 SASI_Mm01_00075366 predicted 1703
7 SASI_Mm01_00075367 predicted 1783
8 SASI_Mm01_00075369 predicted 1751
9 SASI_Mm02_00345798 predicted 1764
10 SASI_Mm02_00345799 predicted 1627
11 SASI_Mm01_00075365 predicted 380
12 SASI_Mm01_00075368 predicted 345
13 SASI_Mm01_00075370 predicted 404
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020225
STOX2 MISSION shRNA Bacterial Glycerol Stock
storkhead box 2
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020225.1-4147s1c1
Sequence:CCGGCCCGACAAATGAAGCTGAGAACTCGAGTTCTCAGCTTCATTTGTCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020225.1-3092s1c1
Sequence:CCGGGAGGTGTGTATTCCAGAGATACTCGAGTATCTCTGGAATACACACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020225.1-2233s1c1
Sequence:CCGGCGGGCTAAAGTTATTCCGGTTCTCGAGAACCGGAATAACTTTAGCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020225.1-3749s1c1
Sequence:CCGGGACTATTACAACGTCTCTGATCTCGAGATCAGAGACGTTGTAATAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137938    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020225.1-4227s1c1
Sequence:CCGGGCCTCAGATCTTCTGTCTCATCTCGAGATGAGACAGAAGATCTGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137542    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020225.1-3991s1c1
Sequence:CCGGCACAGTGGACAGTGGATTCAACTCGAGTTGAATCCACTGTCCACTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020225
STOX2 MISSION shRNA shRNA Plasmid DNA
storkhead box 2
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020225.1-4147s1c1
Sequence:CCGGCCCGACAAATGAAGCTGAGAACTCGAGTTCTCAGCTTCATTTGTCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020225.1-3092s1c1
Sequence:CCGGGAGGTGTGTATTCCAGAGATACTCGAGTATCTCTGGAATACACACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020225.1-2233s1c1
Sequence:CCGGCGGGCTAAAGTTATTCCGGTTCTCGAGAACCGGAATAACTTTAGCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020225.1-3749s1c1
Sequence:CCGGGACTATTACAACGTCTCTGATCTCGAGATCAGAGACGTTGTAATAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137938    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020225.1-4227s1c1
Sequence:CCGGGCCTCAGATCTTCTGTCTCATCTCGAGATGAGACAGAAGATCTGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137542    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020225.1-3991s1c1
Sequence:CCGGCACAGTGGACAGTGGATTCAACTCGAGTTGAATCCACTGTCCACTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020225
STOX2 MISSION shRNA Lentiviral Transduction Particles
storkhead box 2
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020225.1-4147s1c1
Sequence:CCGGCCCGACAAATGAAGCTGAGAACTCGAGTTCTCAGCTTCATTTGTCGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020225.1-3092s1c1
Sequence:CCGGGAGGTGTGTATTCCAGAGATACTCGAGTATCTCTGGAATACACACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138222    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020225.1-2233s1c1
Sequence:CCGGCGGGCTAAAGTTATTCCGGTTCTCGAGAACCGGAATAACTTTAGCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020225.1-3749s1c1
Sequence:CCGGGACTATTACAACGTCTCTGATCTCGAGATCAGAGACGTTGTAATAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137938    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020225.1-4227s1c1
Sequence:CCGGGCCTCAGATCTTCTGTCTCATCTCGAGATGAGACAGAAGATCTGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137542    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020225.1-3991s1c1
Sequence:CCGGCACAGTGGACAGTGGATTCAACTCGAGTTGAATCCACTGTCCACTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175162
STOX2 MISSION shRNA Bacterial Glycerol Stock
storkhead box 2
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000202281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175162.2-1572s1c1
Sequence:CCGGGCGCAAACGATTGGTCATCAACTCGAGTTGATGACCAATCGTTTGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175162.2-1573s1c1
Sequence:CCGGCGCAAACGATTGGTCATCAAACTCGAGTTTGATGACCAATCGTTTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175162.2-715s1c1
Sequence:CCGGCGGAAACTCTCTCGAAACCTACTCGAGTAGGTTTCGAGAGAGTTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175162.2-2108s1c1
Sequence:CCGGCAGCTATCACAAATCTAGCTTCTCGAGAAGCTAGATTTGTGATAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175162
STOX2 MISSION shRNA shRNA Plasmid DNA
storkhead box 2
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000202281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175162.2-1572s1c1
Sequence:CCGGGCGCAAACGATTGGTCATCAACTCGAGTTGATGACCAATCGTTTGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175162.2-1573s1c1
Sequence:CCGGCGCAAACGATTGGTCATCAAACTCGAGTTTGATGACCAATCGTTTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175162.2-715s1c1
Sequence:CCGGCGGAAACTCTCTCGAAACCTACTCGAGTAGGTTTCGAGAGAGTTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175162.2-2108s1c1
Sequence:CCGGCAGCTATCACAAATCTAGCTTCTCGAGAAGCTAGATTTGTGATAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175162
STOX2 MISSION shRNA Lentiviral Transduction Particles
storkhead box 2
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000202281    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175162.2-1572s1c1
Sequence:CCGGGCGCAAACGATTGGTCATCAACTCGAGTTGATGACCAATCGTTTGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175162.2-1573s1c1
Sequence:CCGGCGCAAACGATTGGTCATCAAACTCGAGTTTGATGACCAATCGTTTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175162.2-715s1c1
Sequence:CCGGCGGAAACTCTCTCGAAACCTACTCGAGTAGGTTTCGAGAGAGTTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200896    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175162.2-2108s1c1
Sequence:CCGGCAGCTATCACAAATCTAGCTTCTCGAGAAGCTAGATTTGTGATAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks