EMAIL THIS PAGE TO A FRIEND

STPG1

sperm-tail PG-rich repeat containing 1

Synonyms: C1orf201 MAPO2
UniProtKB ID: Q5TH74, Q49AP0, Q6P3R4, Q86VU9, Q8WVQ3
Gene ID:
Mouse(78806) sperm tail PG rich repeat containing 1
Rat(500566) sperm-tail PG-rich repeat containing 1
Zebrafish(100002345) sperm-tail PG-rich repeat containing 1
dog(612269) sperm-tail PG-rich repeat containing 1
domestic cat(101097744) sperm-tail PG-rich repeat containing 1
cow(616738) sperm-tail PG-rich repeat containing 1
sheep(101117651) sperm-tail PG-rich repeat containing 1
naked mole-rat(101722553) sperm-tail PG-rich repeat containing 1
domestic guinea pig(100712748) sperm-tail PG-rich repeat containing 1
84 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030189 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_030189 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_030189 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_178122 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_178122 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_178122 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_178122 Rosetta Predictions human pricing
NM_001025772 Rosetta Predictions rat pricing
NM_030189 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178122 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00079040 predicted 289
2 SASI_Hs01_00079041 predicted 475
3 SASI_Hs01_00079042 predicted 541
4 SASI_Hs01_00079043 predicted 356
5 SASI_Hs01_00079044 predicted 806
6 SASI_Hs01_00079045 predicted 517
7 SASI_Hs01_00079047 predicted 433
8 SASI_Hs01_00079049 predicted 210
9 SASI_Hs02_00369526 predicted 319
10 SASI_Hs02_00369527 predicted 560
11 SASI_Hs01_00079046 predicted 802
12 SASI_Hs01_00079048 predicted 363
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025772 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00054706 predicted 304
2 SASI_Rn01_00054708 predicted 1103
3 SASI_Rn01_00054709 predicted 981
4 SASI_Rn01_00054710 predicted 854
5 SASI_Rn01_00054711 predicted 300
6 SASI_Rn01_00054712 predicted 538
7 SASI_Rn01_00054713 predicted 262
8 SASI_Rn02_00203451 predicted 1156
9 SASI_Rn02_00203452 predicted 757
10 SASI_Rn01_00054714 predicted 578
11 SASI_Rn01_00054707 predicted 1033
12 SASI_Rn01_00054715 predicted 1267
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030189 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00040914 predicted 818
2 SASI_Mm01_00040915 predicted 541
3 SASI_Mm01_00040916 predicted 904
4 SASI_Mm01_00040917 predicted 557
5 SASI_Mm01_00040918 predicted 1079
6 SASI_Mm01_00040919 predicted 626
7 SASI_Mm01_00040920 predicted 1664
8 SASI_Mm01_00040921 predicted 853
9 SASI_Mm01_00040922 predicted 916
10 SASI_Mm01_00040923 predicted 265
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030189
STPG1 MISSION shRNA Bacterial Glycerol Stock
sperm-tail PG-rich repeat containing 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000200131    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030189.1-484s1c1
Sequence:CCGGCAAGAGAGGAACGTGCACTTTCTCGAGAAAGTGCACGTTCCTCTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030189.1-1167s1c1
Sequence:CCGGCAGAGATTCCAGGGAAGCAATCTCGAGATTGCTTCCCTGGAATCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181351    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_030189.1-1639s1c1
Sequence:CCGGCCTCAGCTATGCCTTGTTATTCTCGAGAATAACAAGGCATAGCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030189.1-923s1c1
Sequence:CCGGCCGAATGATCAAACCAAGATTCTCGAGAATCTTGGTTTGATCATTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030189.1-1193s1c1
Sequence:CCGGCTCTACAATGAAGACAACAAACTCGAGTTTGTTGTCTTCATTGTAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030189.1-829s1c1
Sequence:CCGGGCAATCGCCAAAGTTCTTAATCTCGAGATTAAGAACTTTGGCGATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217542    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030189.2-1036s1c1
Sequence:CCGGCAGTATGAGATCGTGAACTACCTCGAGGTAGTTCACGATCTCATACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217020    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030189.2-588s1c1
Sequence:CCGGCAAGAAGGACTTCAGCAATTCCTCGAGGAATTGCTGAAGTCCTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217039    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_030189.2-1993s1c1
Sequence:CCGGCTATCCCAGACACTGATAATGCTCGAGCATTATCAGTGTCTGGGATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030189
STPG1 MISSION shRNA shRNA Plasmid DNA
sperm-tail PG-rich repeat containing 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000200131    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030189.1-484s1c1
Sequence:CCGGCAAGAGAGGAACGTGCACTTTCTCGAGAAAGTGCACGTTCCTCTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030189.1-1167s1c1
Sequence:CCGGCAGAGATTCCAGGGAAGCAATCTCGAGATTGCTTCCCTGGAATCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181351    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_030189.1-1639s1c1
Sequence:CCGGCCTCAGCTATGCCTTGTTATTCTCGAGAATAACAAGGCATAGCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030189.1-923s1c1
Sequence:CCGGCCGAATGATCAAACCAAGATTCTCGAGAATCTTGGTTTGATCATTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030189.1-1193s1c1
Sequence:CCGGCTCTACAATGAAGACAACAAACTCGAGTTTGTTGTCTTCATTGTAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030189.1-829s1c1
Sequence:CCGGGCAATCGCCAAAGTTCTTAATCTCGAGATTAAGAACTTTGGCGATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217542    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030189.2-1036s1c1
Sequence:CCGGCAGTATGAGATCGTGAACTACCTCGAGGTAGTTCACGATCTCATACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217020    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030189.2-588s1c1
Sequence:CCGGCAAGAAGGACTTCAGCAATTCCTCGAGGAATTGCTGAAGTCCTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217039    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_030189.2-1993s1c1
Sequence:CCGGCTATCCCAGACACTGATAATGCTCGAGCATTATCAGTGTCTGGGATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030189
STPG1 MISSION shRNA Lentiviral Transduction Particles
sperm-tail PG-rich repeat containing 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000200131    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030189.1-484s1c1
Sequence:CCGGCAAGAGAGGAACGTGCACTTTCTCGAGAAAGTGCACGTTCCTCTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030189.1-1167s1c1
Sequence:CCGGCAGAGATTCCAGGGAAGCAATCTCGAGATTGCTTCCCTGGAATCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181351    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_030189.1-1639s1c1
Sequence:CCGGCCTCAGCTATGCCTTGTTATTCTCGAGAATAACAAGGCATAGCTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178620    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030189.1-923s1c1
Sequence:CCGGCCGAATGATCAAACCAAGATTCTCGAGAATCTTGGTTTGATCATTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030189.1-1193s1c1
Sequence:CCGGCTCTACAATGAAGACAACAAACTCGAGTTTGTTGTCTTCATTGTAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030189.1-829s1c1
Sequence:CCGGGCAATCGCCAAAGTTCTTAATCTCGAGATTAAGAACTTTGGCGATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217542    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030189.2-1036s1c1
Sequence:CCGGCAGTATGAGATCGTGAACTACCTCGAGGTAGTTCACGATCTCATACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217020    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030189.2-588s1c1
Sequence:CCGGCAAGAAGGACTTCAGCAATTCCTCGAGGAATTGCTGAAGTCCTTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217039    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_030189.2-1993s1c1
Sequence:CCGGCTATCCCAGACACTGATAATGCTCGAGCATTATCAGTGTCTGGGATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178122
STPG1 MISSION shRNA Bacterial Glycerol Stock
sperm-tail PG-rich repeat containing 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138210    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178122.2-1354s1c1
Sequence:CCGGCCCTTCCCTGTTTCATTCCTTCTCGAGAAGGAATGAAACAGGGAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178122.2-377s1c1
Sequence:CCGGGCTCTCAAGTTTGAAACTCCTCTCGAGAGGAGTTTCAAACTTGAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178122.2-395s1c1
Sequence:CCGGCCTGCACCAAACTATTACAATCTCGAGATTGTAATAGTTTGGTGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178122.2-520s1c1
Sequence:CCGGCCCAGGGCATTATGATATCAACTCGAGTTGATATCATAATGCCCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178122.2-355s1c1
Sequence:CCGGCCAGTTGCCAAGCTTTATGAACTCGAGTTCATAAAGCTTGGCAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178122.2-925s1c1
Sequence:CCGGCAACGAGGACAAGAAATGGATCTCGAGATCCATTTCTTGTCCTCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427544    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178122.3-767s21c1
Sequence:CCGGATGAGATCGTGGACTACTTAGCTCGAGCTAAGTAGTCCACGATCTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178122.3-291s21c1
Sequence:CCGGATACACTATCCCATCGGATTTCTCGAGAAATCCGATGGGATAGTGTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178122
STPG1 MISSION shRNA shRNA Plasmid DNA
sperm-tail PG-rich repeat containing 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138210    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178122.2-1354s1c1
Sequence:CCGGCCCTTCCCTGTTTCATTCCTTCTCGAGAAGGAATGAAACAGGGAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178122.2-377s1c1
Sequence:CCGGGCTCTCAAGTTTGAAACTCCTCTCGAGAGGAGTTTCAAACTTGAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178122.2-395s1c1
Sequence:CCGGCCTGCACCAAACTATTACAATCTCGAGATTGTAATAGTTTGGTGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178122.2-520s1c1
Sequence:CCGGCCCAGGGCATTATGATATCAACTCGAGTTGATATCATAATGCCCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178122.2-355s1c1
Sequence:CCGGCCAGTTGCCAAGCTTTATGAACTCGAGTTCATAAAGCTTGGCAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178122.2-925s1c1
Sequence:CCGGCAACGAGGACAAGAAATGGATCTCGAGATCCATTTCTTGTCCTCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427544    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178122.3-767s21c1
Sequence:CCGGATGAGATCGTGGACTACTTAGCTCGAGCTAAGTAGTCCACGATCTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178122.3-291s21c1
Sequence:CCGGATACACTATCCCATCGGATTTCTCGAGAAATCCGATGGGATAGTGTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178122
STPG1 MISSION shRNA Lentiviral Transduction Particles
sperm-tail PG-rich repeat containing 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138210    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178122.2-1354s1c1
Sequence:CCGGCCCTTCCCTGTTTCATTCCTTCTCGAGAAGGAATGAAACAGGGAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136664    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178122.2-377s1c1
Sequence:CCGGGCTCTCAAGTTTGAAACTCCTCTCGAGAGGAGTTTCAAACTTGAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178122.2-395s1c1
Sequence:CCGGCCTGCACCAAACTATTACAATCTCGAGATTGTAATAGTTTGGTGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178122.2-520s1c1
Sequence:CCGGCCCAGGGCATTATGATATCAACTCGAGTTGATATCATAATGCCCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136928    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178122.2-355s1c1
Sequence:CCGGCCAGTTGCCAAGCTTTATGAACTCGAGTTCATAAAGCTTGGCAACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178122.2-925s1c1
Sequence:CCGGCAACGAGGACAAGAAATGGATCTCGAGATCCATTTCTTGTCCTCGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427544    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178122.3-767s21c1
Sequence:CCGGATGAGATCGTGGACTACTTAGCTCGAGCTAAGTAGTCCACGATCTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178122.3-291s21c1
Sequence:CCGGATACACTATCCCATCGGATTTCTCGAGAAATCCGATGGGATAGTGTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks