EMAIL THIS PAGE TO A FRIEND

STPG2

sperm-tail PG-rich repeat containing 2

Synonyms: C4orf37
UniProtKB ID: Q8N412
Gene ID:
Mouse(381476) sperm tail PG rich repeat containing 2
Rat(499719) sperm-tail PG-rich repeat containing 2
domestic guinea pig(100721070) sperm-tail PG-rich repeat containing 2
naked mole-rat(101728486) sperm-tail PG-rich repeat containing 2
sheep(101102064) sperm-tail PG-rich repeat containing 2
domestic cat(101089186) sperm-tail PG-rich repeat containing 2
40 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301089 ANTI-C4ORF37 (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
flow cytometry, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_174952 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_174952 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_174952 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_198659 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_198659 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_198659 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU017721 MISSION® esiRNA esiRNA targeting human C4orf37 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_174952 Rosetta Predictions human pricing
NM_001100993 Rosetta Predictions rat pricing
NM_198659 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_174952 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00188261 predicted 337
2 SASI_Hs01_00188262 predicted 1331
3 SASI_Hs01_00188263 predicted 1159
4 SASI_Hs01_00188264 predicted 445
5 SASI_Hs01_00188265 predicted 452
6 SASI_Hs01_00188266 predicted 955
7 SASI_Hs02_00368889 predicted 382
8 SASI_Hs01_00188267 predicted 1392
9 SASI_Hs01_00188268 predicted 280
10 SASI_Hs01_00188270 predicted 1059
11 SASI_Hs01_00188269 predicted 441
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100993 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00211072 predicted 1732
2 SASI_Rn02_00211073 predicted 696
3 SASI_Rn02_00211074 predicted 1543
4 SASI_Rn02_00211075 predicted 1198
5 SASI_Rn02_00211076 predicted 869
6 SASI_Rn02_00211077 predicted 625
7 SASI_Rn02_00211078 predicted 1179
8 SASI_Rn02_00211079 predicted 809
9 SASI_Rn02_00211080 predicted 1195
10 SASI_Rn02_00211081 predicted 1801
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198659 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00097967 predicted 675
2 SASI_Mm01_00097968 predicted 1534
3 SASI_Mm01_00097969 predicted 503
4 SASI_Mm01_00097970 predicted 195
5 SASI_Mm01_00097971 predicted 673
6 SASI_Mm01_00097972 predicted 361
7 SASI_Mm01_00097973 predicted 850
8 SASI_Mm01_00097974 predicted 315
9 SASI_Mm01_00097975 predicted 210
10 SASI_Mm01_00097976 predicted 1068
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_174952
STPG2 MISSION shRNA Bacterial Glycerol Stock
sperm-tail PG-rich repeat containing 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000282839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174952.1-730s21c1
Sequence:CCGGCCGGCTCCTGGCACATATAATCTCGAGATTATATGTGCCAGGAGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263862    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_174952.1-1503s21c1
Sequence:CCGGTTCATGGAAGTCAGTTTATTTCTCGAGAAATAAACTGACTTCCATGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263861    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174952.1-277s21c1
Sequence:CCGGCCAGGTCCAGGACACTATAATCTCGAGATTATAGTGTCCTGGACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174952.1-1064s21c1
Sequence:CCGGTACCTAACTTGACTAACAAATCTCGAGATTTGTTAGTCAAGTTAGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173104    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_174952.1-1596s1c1
Sequence:CCGGCGCTCAGGCTTTAGTGACTATCTCGAGATAGTCACTAAAGCCTGAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172325    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174952.1-194s1c1
Sequence:CCGGCGACAGGTAGTAATGCACCATCTCGAGATGGTGCATTACTACCTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166990    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174952.1-1009s1c1
Sequence:CCGGCCTGCTGATTATCAGGAATTTCTCGAGAAATTCCTGATAATCAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_174952
STPG2 MISSION shRNA shRNA Plasmid DNA
sperm-tail PG-rich repeat containing 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000282839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174952.1-730s21c1
Sequence:CCGGCCGGCTCCTGGCACATATAATCTCGAGATTATATGTGCCAGGAGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263862    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_174952.1-1503s21c1
Sequence:CCGGTTCATGGAAGTCAGTTTATTTCTCGAGAAATAAACTGACTTCCATGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263861    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174952.1-277s21c1
Sequence:CCGGCCAGGTCCAGGACACTATAATCTCGAGATTATAGTGTCCTGGACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174952.1-1064s21c1
Sequence:CCGGTACCTAACTTGACTAACAAATCTCGAGATTTGTTAGTCAAGTTAGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173104    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_174952.1-1596s1c1
Sequence:CCGGCGCTCAGGCTTTAGTGACTATCTCGAGATAGTCACTAAAGCCTGAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172325    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174952.1-194s1c1
Sequence:CCGGCGACAGGTAGTAATGCACCATCTCGAGATGGTGCATTACTACCTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166990    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174952.1-1009s1c1
Sequence:CCGGCCTGCTGATTATCAGGAATTTCTCGAGAAATTCCTGATAATCAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_174952
STPG2 MISSION shRNA Lentiviral Transduction Particles
sperm-tail PG-rich repeat containing 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000282839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174952.1-730s21c1
Sequence:CCGGCCGGCTCCTGGCACATATAATCTCGAGATTATATGTGCCAGGAGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263862    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_174952.1-1503s21c1
Sequence:CCGGTTCATGGAAGTCAGTTTATTTCTCGAGAAATAAACTGACTTCCATGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263861    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174952.1-277s21c1
Sequence:CCGGCCAGGTCCAGGACACTATAATCTCGAGATTATAGTGTCCTGGACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263860    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_174952.1-1064s21c1
Sequence:CCGGTACCTAACTTGACTAACAAATCTCGAGATTTGTTAGTCAAGTTAGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173104    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_174952.1-1596s1c1
Sequence:CCGGCGCTCAGGCTTTAGTGACTATCTCGAGATAGTCACTAAAGCCTGAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172325    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174952.1-194s1c1
Sequence:CCGGCGACAGGTAGTAATGCACCATCTCGAGATGGTGCATTACTACCTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166990    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_174952.1-1009s1c1
Sequence:CCGGCCTGCTGATTATCAGGAATTTCTCGAGAAATTCCTGATAATCAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198659
STPG2 MISSION shRNA Bacterial Glycerol Stock
sperm-tail PG-rich repeat containing 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198659.2-758s21c1
Sequence:CCGGGACCTGGAAAGTACAACATTACTCGAGTAATGTTGTACTTTCCAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265105    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198659.2-2048s21c1
Sequence:CCGGTGCTACGCTCCTGGCTAATTTCTCGAGAAATTAGCCAGGAGCGTAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265104    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198659.2-1462s21c1
Sequence:CCGGGCCATAATCTCATTCGTTAAACTCGAGTTTAACGAATGAGATTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198659.2-709s21c1
Sequence:CCGGCGGCTATATGAAGCGATAATACTCGAGTATTATCGCTTCATATAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265107    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198659.2-441s21c1
Sequence:CCGGCAATGACGATGACACTATTATCTCGAGATAATAGTGTCATCGTCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215531    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198659.2-1462s1c1
Sequence:CCGGGCCATAATCTCATTCGTTAAACTCGAGTTTAACGAATGAGATTATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217402    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198659.2-758s1c1
Sequence:CCGGGACCTGGAAAGTACAACATTACTCGAGTAATGTTGTACTTTCCAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200901    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198659.1-1905s1c1
Sequence:CCGGCCAGATGAAATGTGGGCTTAACTCGAGTTAAGCCCACATTTCATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200551    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198659.1-384s1c1
Sequence:CCGGCCAGAAACATTGATATTCCTTCTCGAGAAGGAATATCAATGTTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198659
STPG2 MISSION shRNA shRNA Plasmid DNA
sperm-tail PG-rich repeat containing 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198659.2-758s21c1
Sequence:CCGGGACCTGGAAAGTACAACATTACTCGAGTAATGTTGTACTTTCCAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265105    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198659.2-2048s21c1
Sequence:CCGGTGCTACGCTCCTGGCTAATTTCTCGAGAAATTAGCCAGGAGCGTAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265104    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198659.2-1462s21c1
Sequence:CCGGGCCATAATCTCATTCGTTAAACTCGAGTTTAACGAATGAGATTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198659.2-709s21c1
Sequence:CCGGCGGCTATATGAAGCGATAATACTCGAGTATTATCGCTTCATATAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265107    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198659.2-441s21c1
Sequence:CCGGCAATGACGATGACACTATTATCTCGAGATAATAGTGTCATCGTCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215531    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198659.2-1462s1c1
Sequence:CCGGGCCATAATCTCATTCGTTAAACTCGAGTTTAACGAATGAGATTATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217402    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198659.2-758s1c1
Sequence:CCGGGACCTGGAAAGTACAACATTACTCGAGTAATGTTGTACTTTCCAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200901    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198659.1-1905s1c1
Sequence:CCGGCCAGATGAAATGTGGGCTTAACTCGAGTTAAGCCCACATTTCATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200551    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198659.1-384s1c1
Sequence:CCGGCCAGAAACATTGATATTCCTTCTCGAGAAGGAATATCAATGTTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198659
STPG2 MISSION shRNA Lentiviral Transduction Particles
sperm-tail PG-rich repeat containing 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198659.2-758s21c1
Sequence:CCGGGACCTGGAAAGTACAACATTACTCGAGTAATGTTGTACTTTCCAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265105    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198659.2-2048s21c1
Sequence:CCGGTGCTACGCTCCTGGCTAATTTCTCGAGAAATTAGCCAGGAGCGTAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265104    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198659.2-1462s21c1
Sequence:CCGGGCCATAATCTCATTCGTTAAACTCGAGTTTAACGAATGAGATTATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198659.2-709s21c1
Sequence:CCGGCGGCTATATGAAGCGATAATACTCGAGTATTATCGCTTCATATAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265107    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198659.2-441s21c1
Sequence:CCGGCAATGACGATGACACTATTATCTCGAGATAATAGTGTCATCGTCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215531    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198659.2-1462s1c1
Sequence:CCGGGCCATAATCTCATTCGTTAAACTCGAGTTTAACGAATGAGATTATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217402    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198659.2-758s1c1
Sequence:CCGGGACCTGGAAAGTACAACATTACTCGAGTAATGTTGTACTTTCCAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200901    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_198659.1-1905s1c1
Sequence:CCGGCCAGATGAAATGTGGGCTTAACTCGAGTTAAGCCCACATTTCATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200551    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198659.1-384s1c1
Sequence:CCGGCCAGAAACATTGATATTCCTTCTCGAGAAGGAATATCAATGTTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks