EMAIL THIS PAGE TO A FRIEND

STRA13

stimulated by retinoic acid 13

Synonyms: CENP-X CENPX D9 FAAP10 MHF2
UniProtKB ID: A8MT69, O00281, O00282, Q96DD4, Q96F51
Gene ID:
Mouse(20892) stimulated by retinoic acid 13
Zebrafish(100332714) stimulated by retinoic acid 13 homolog (mouse)
chicken(101667047) stimulated by retinoic acid 13
chicken(101751277) stimulated by retinoic acid 13
domestic cat(101101429) stimulated by retinoic acid 13 homolog (mouse)
cow(618018) stimulated by retinoic acid 13 homolog (mouse)
sheep(101107297) stimulated by retinoic acid 13 homolog (mouse)
naked mole-rat(101722025) stimulated by retinoic acid 13
domestic guinea pig(100715209) stimulated by retinoic acid 13
41 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016665 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016665 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016665 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_144998 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144998 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144998 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_144998 Rosetta Predictions human pricing
NM_016665 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144998 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00081890 predicted 311
2 SASI_Hs01_00081891 predicted 336
3 SASI_Hs01_00081892 predicted 469
4 SASI_Hs01_00081893 predicted 199
5 SASI_Hs01_00081894 predicted 315
6 SASI_Hs01_00081896 predicted 405
7 SASI_Hs01_00081897 predicted 224
8 SASI_Hs01_00081898 predicted 317
9 SASI_Hs02_00364831 predicted 305
10 SASI_Hs02_00364832 predicted 353
11 SASI_Hs01_00081889 predicted 329
12 SASI_Hs01_00081895 predicted 337
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016665 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00138550 predicted 297
2 SASI_Mm01_00138552 predicted 211
3 SASI_Mm02_00323278 predicted 361
4 SASI_Mm02_00323279 predicted 228
5 SASI_Mm02_00323280 predicted 329
6 SASI_Mm02_00323281 predicted 207
7 SASI_Mm02_00323282 predicted 566
8 SASI_Mm01_00138551 predicted 130
9 SASI_Mm01_00138556 predicted 82
10 SASI_Mm02_00323283 predicted 55
11 SASI_Mm01_00138553 predicted 225
12 SASI_Mm01_00138554 predicted 258
13 SASI_Mm01_00138555 predicted 270
14 SASI_Mm01_00138557 predicted 203
15 SASI_Mm01_00138558 predicted 353
16 SASI_Mm01_00138559 predicted 262
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016665
STRA13 MISSION shRNA Bacterial Glycerol Stock
stimulated by retinoic acid 13
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000179021    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016665.1-244s1c1
Sequence:CCGGCACAAACTACCACCAACCTTTCTCGAGAAAGGTTGGTGGTAGTTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178776    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016665.1-260s1c1
Sequence:CCGGCCTTTCAGTTCTCAAGCCATTCTCGAGAATGGCTTGAGAACTGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016665.2-161s21c1
Sequence:CCGGTCCTGAGGATCTTCGTACTAGCTCGAGCTAGTACGAAGATCCTCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016665.2-213s21c1
Sequence:CCGGGGCAGAAGACCTGGATGTTGTCTCGAGACAACATCCAGGTCTTCTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249975    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016665.2-461s21c1
Sequence:CCGGCCAGCAGCCTTGCATTATAAACTCGAGTTTATAATGCAAGGCTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016665.2-107s21c1
Sequence:CCGGTCAGGGATTGCAAGACCAAAGCTCGAGCTTTGGTCTTGCAATCCCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249972    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016665.2-81s21c1
Sequence:CCGGGGTGAGCAGACTACTCCATTTCTCGAGAAATGGAGTAGTCTGCTCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016665
STRA13 MISSION shRNA shRNA Plasmid DNA
stimulated by retinoic acid 13
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000179021    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016665.1-244s1c1
Sequence:CCGGCACAAACTACCACCAACCTTTCTCGAGAAAGGTTGGTGGTAGTTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178776    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016665.1-260s1c1
Sequence:CCGGCCTTTCAGTTCTCAAGCCATTCTCGAGAATGGCTTGAGAACTGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016665.2-161s21c1
Sequence:CCGGTCCTGAGGATCTTCGTACTAGCTCGAGCTAGTACGAAGATCCTCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016665.2-213s21c1
Sequence:CCGGGGCAGAAGACCTGGATGTTGTCTCGAGACAACATCCAGGTCTTCTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249975    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016665.2-461s21c1
Sequence:CCGGCCAGCAGCCTTGCATTATAAACTCGAGTTTATAATGCAAGGCTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016665.2-107s21c1
Sequence:CCGGTCAGGGATTGCAAGACCAAAGCTCGAGCTTTGGTCTTGCAATCCCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249972    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016665.2-81s21c1
Sequence:CCGGGGTGAGCAGACTACTCCATTTCTCGAGAAATGGAGTAGTCTGCTCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016665
STRA13 MISSION shRNA Lentiviral Transduction Particles
stimulated by retinoic acid 13
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000179021    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016665.1-244s1c1
Sequence:CCGGCACAAACTACCACCAACCTTTCTCGAGAAAGGTTGGTGGTAGTTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178776    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016665.1-260s1c1
Sequence:CCGGCCTTTCAGTTCTCAAGCCATTCTCGAGAATGGCTTGAGAACTGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249971    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016665.2-161s21c1
Sequence:CCGGTCCTGAGGATCTTCGTACTAGCTCGAGCTAGTACGAAGATCCTCAGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249973    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016665.2-213s21c1
Sequence:CCGGGGCAGAAGACCTGGATGTTGTCTCGAGACAACATCCAGGTCTTCTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249975    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016665.2-461s21c1
Sequence:CCGGCCAGCAGCCTTGCATTATAAACTCGAGTTTATAATGCAAGGCTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249974    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016665.2-107s21c1
Sequence:CCGGTCAGGGATTGCAAGACCAAAGCTCGAGCTTTGGTCTTGCAATCCCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249972    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016665.2-81s21c1
Sequence:CCGGGGTGAGCAGACTACTCCATTTCTCGAGAAATGGAGTAGTCTGCTCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144998
VALIDATED
STRA13 MISSION shRNA Bacterial Glycerol Stock
stimulated by retinoic acid 13
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000072738    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144998.1-672s1c1
Sequence:CCGGCTCACAAAGCAACATCAATAACTCGAGTTATTGATGTTGCTTTGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144998.1-85s1c1
Sequence:CCGGTCAAGGATGACAAGACCAAAGCTCGAGCTTTGGTCTTGTCATCCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_144998.1-77s1c1
Sequence:CCGGCCTGCACTTCAAGGATGACAACTCGAGTTGTCATCCTTGAAGTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144998.1-176s1c1
Sequence:CCGGGAAGGTGCTTCCGCAGCTGCTCTCGAGAGCAGCTGCGGAAGCACCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_144998.1-74s1c1
Sequence:CCGGGCACCTGCACTTCAAGGATGACTCGAGTCATCCTTGAAGTGCAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436423    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144998.2-549s21c1
Sequence:CCGGTAGCCTGTGTGTTTGACAAACCTCGAGGTTTGTCAAACACACAGGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420043    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144998.2-613s21c1
Sequence:CCGGACATCAAAGCTGGCGTGTGACCTCGAGGTCACACGCCAGCTTTGATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418562    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144998.2-633s21c1
Sequence:CCGGCCTTTCCAGCCATGCGATATTCTCGAGAATATCGCATGGCTGGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419406    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144998.2-332s21c1
Sequence:CCGGAGGATTTGGAGTTGATTCAAACTCGAGTTTGAATCAACTCCAAATCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428585    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144998.2-672s21c1
Sequence:CCGGCCCAGGCTATAAATTTGTTCTCTCGAGAGAACAAATTTATAGCCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425073    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144998.2-343s21c1
Sequence:CCGGTTGATTCAAACAAGATCTCTGCTCGAGCAGAGATCTTGTTTGAATCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144998
VALIDATED
STRA13 MISSION shRNA shRNA Plasmid DNA
stimulated by retinoic acid 13
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000072738    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144998.1-672s1c1
Sequence:CCGGCTCACAAAGCAACATCAATAACTCGAGTTATTGATGTTGCTTTGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144998.1-85s1c1
Sequence:CCGGTCAAGGATGACAAGACCAAAGCTCGAGCTTTGGTCTTGTCATCCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_144998.1-77s1c1
Sequence:CCGGCCTGCACTTCAAGGATGACAACTCGAGTTGTCATCCTTGAAGTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144998.1-176s1c1
Sequence:CCGGGAAGGTGCTTCCGCAGCTGCTCTCGAGAGCAGCTGCGGAAGCACCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_144998.1-74s1c1
Sequence:CCGGGCACCTGCACTTCAAGGATGACTCGAGTCATCCTTGAAGTGCAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436423    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144998.2-549s21c1
Sequence:CCGGTAGCCTGTGTGTTTGACAAACCTCGAGGTTTGTCAAACACACAGGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420043    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144998.2-613s21c1
Sequence:CCGGACATCAAAGCTGGCGTGTGACCTCGAGGTCACACGCCAGCTTTGATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418562    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144998.2-633s21c1
Sequence:CCGGCCTTTCCAGCCATGCGATATTCTCGAGAATATCGCATGGCTGGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419406    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144998.2-332s21c1
Sequence:CCGGAGGATTTGGAGTTGATTCAAACTCGAGTTTGAATCAACTCCAAATCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428585    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144998.2-672s21c1
Sequence:CCGGCCCAGGCTATAAATTTGTTCTCTCGAGAGAACAAATTTATAGCCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425073    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144998.2-343s21c1
Sequence:CCGGTTGATTCAAACAAGATCTCTGCTCGAGCAGAGATCTTGTTTGAATCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144998
VALIDATED
STRA13 MISSION shRNA Lentiviral Transduction Particles
stimulated by retinoic acid 13
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000072738    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144998.1-672s1c1
Sequence:CCGGCTCACAAAGCAACATCAATAACTCGAGTTATTGATGTTGCTTTGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072741    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144998.1-85s1c1
Sequence:CCGGTCAAGGATGACAAGACCAAAGCTCGAGCTTTGGTCTTGTCATCCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_144998.1-77s1c1
Sequence:CCGGCCTGCACTTCAAGGATGACAACTCGAGTTGTCATCCTTGAAGTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072740    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144998.1-176s1c1
Sequence:CCGGGAAGGTGCTTCCGCAGCTGCTCTCGAGAGCAGCTGCGGAAGCACCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_144998.1-74s1c1
Sequence:CCGGGCACCTGCACTTCAAGGATGACTCGAGTCATCCTTGAAGTGCAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436423    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144998.2-549s21c1
Sequence:CCGGTAGCCTGTGTGTTTGACAAACCTCGAGGTTTGTCAAACACACAGGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420043    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144998.2-613s21c1
Sequence:CCGGACATCAAAGCTGGCGTGTGACCTCGAGGTCACACGCCAGCTTTGATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418562    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144998.2-633s21c1
Sequence:CCGGCCTTTCCAGCCATGCGATATTCTCGAGAATATCGCATGGCTGGAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419406    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144998.2-332s21c1
Sequence:CCGGAGGATTTGGAGTTGATTCAAACTCGAGTTTGAATCAACTCCAAATCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428585    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144998.2-672s21c1
Sequence:CCGGCCCAGGCTATAAATTTGTTCTCTCGAGAGAACAAATTTATAGCCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425073    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144998.2-343s21c1
Sequence:CCGGTTGATTCAAACAAGATCTCTGCTCGAGCAGAGATCTTGTTTGAATCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks