EMAIL THIS PAGE TO A FRIEND

STRA6

stimulated by retinoic acid 6

Synonyms: MCOPCB8 MCOPS9
Gene ID:
Human(64220) Summary: The protein encoded by this gene is a membrane protein involved in the metabolism of retinol. The encoded protein acts as a receptor for retinol/retinol binding protein complexes. This protein removes the retinol from the complex and transports it across the cell membrane. Defects in this gene are a cause of syndromic microphthalmia type 9 (MCOPS9). Several transcript variants encoding a few different isoforms have been found for this gene. [provided by RefSeq, Dec 2008]
Mouse(20897) stimulated by retinoic acid gene 6
Rat(363071) stimulated by retinoic acid 6
domestic guinea pig(100721376) stimulated by retinoic acid 6
naked mole-rat(101704953) stimulated by retinoic acid 6
cow(515911) stimulated by retinoic acid gene 6 homolog (mouse)
sheep(101120527) stimulated by retinoic acid 6 homolog (mouse)
Zebrafish(724007) stimulated by retinoic acid gene 6 homolog (mouse)
domestic cat(101089109) stimulated by retinoic acid gene 6 homolog (mouse)
dog(611518) stimulated by retinoic acid gene 6 homolog (mouse)
chicken(415301) stimulated by retinoic acid gene 6 homolog (mouse)
56 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022369 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022369 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022369 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009291 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009291 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009291 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU092561 MISSION® esiRNA esiRNA human STRA6 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022369 Rosetta Predictions human pricing
NM_001029924 Rosetta Predictions rat pricing
NM_009291 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022369 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00242134 predicted 1845
2 SASI_Hs01_00242135 predicted 2122
3 SASI_Hs01_00242136 predicted 829
4 SASI_Hs02_00355670 predicted 1409
5 SASI_Hs01_00242137 predicted 1326
6 SASI_Hs01_00242138 predicted 744
7 SASI_Hs02_00355671 predicted 2332
8 SASI_Hs01_00242139 predicted 591
9 SASI_Hs01_00242141 predicted 1048
10 SASI_Hs01_00242142 predicted 1292
11 SASI_Hs01_00242140 predicted 2479
12 SASI_Hs01_00242143 predicted 1104
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001029924 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00044207 predicted 709
2 SASI_Rn01_00044208 predicted 1711
3 SASI_Rn01_00044209 predicted 1472
4 SASI_Rn01_00044210 predicted 1645
5 SASI_Rn01_00044211 predicted 1382
6 SASI_Rn02_00203497 predicted 334
7 SASI_Rn01_00044212 predicted 1122
8 SASI_Rn01_00044213 predicted 951
9 SASI_Rn01_00044215 predicted 1724
10 SASI_Rn01_00044216 predicted 1366
11 SASI_Rn01_00044214 predicted 2111
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009291 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00098283 predicted 862
2 SASI_Mm01_00098284 predicted 2374
3 SASI_Mm01_00098285 predicted 1964
4 SASI_Mm01_00098286 predicted 2074
5 SASI_Mm01_00098287 predicted 2274
6 SASI_Mm01_00098288 predicted 934
7 SASI_Mm01_00098289 predicted 879
8 SASI_Mm01_00098290 predicted 412
9 SASI_Mm01_00098291 predicted 2385
10 SASI_Mm01_00098292 predicted 1573
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022369
STRA6 MISSION shRNA Bacterial Glycerol Stock
stimulated by retinoic acid 6
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000439936    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022369.3-223s21c1
Sequence:CCGGCCACAGAGGACTACTCCTATGCTCGAGCATAGGAGTAGTCCTCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022369.3-1339s21c1
Sequence:CCGGTGACACACAGGACCAACCTTCCTCGAGGAAGGTTGGTCCTGTGTGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022369.3-1262s21c1
Sequence:CCGGGGCTCTGGAAGTGTGCTACATCTCGAGATGTAGCACACTTCCAGAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022369.3-1046s21c1
Sequence:CCGGAGGATTCCATCTCCCGCTGAACTCGAGTTCAGCGGGAGATGGAATCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184033    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022369.2-589s1c1
Sequence:CCGGCTGGAAGATACTGGGACTGTTCTCGAGAACAGTCCCAGTATCTTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179804    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022369.2-1396s1c1
Sequence:CCGGCCAAGCCATATTCTGTTGGATCTCGAGATCCAACAGAATATGGCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022369.2-899s1c1
Sequence:CCGGGAATATCTGAGGAACCTCCTTCTCGAGAAGGAGGTTCCTCAGATATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022369.2-607s1c1
Sequence:CCGGGTTCTATTATGCTGCCCTCTACTCGAGTAGAGGGCAGCATAATAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022369.2-745s1c1
Sequence:CCGGGCCCAAGATCTACAAGTACTACTCGAGTAGTACTTGTAGATCTTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022369.2-1848s1c1
Sequence:CCGGCGTACCGAAACTTCTTGAAGACTCGAGTCTTCAAGAAGTTTCGGTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022369
STRA6 MISSION shRNA shRNA Plasmid DNA
stimulated by retinoic acid 6
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000439936    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022369.3-223s21c1
Sequence:CCGGCCACAGAGGACTACTCCTATGCTCGAGCATAGGAGTAGTCCTCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022369.3-1339s21c1
Sequence:CCGGTGACACACAGGACCAACCTTCCTCGAGGAAGGTTGGTCCTGTGTGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022369.3-1262s21c1
Sequence:CCGGGGCTCTGGAAGTGTGCTACATCTCGAGATGTAGCACACTTCCAGAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022369.3-1046s21c1
Sequence:CCGGAGGATTCCATCTCCCGCTGAACTCGAGTTCAGCGGGAGATGGAATCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184033    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022369.2-589s1c1
Sequence:CCGGCTGGAAGATACTGGGACTGTTCTCGAGAACAGTCCCAGTATCTTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179804    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022369.2-1396s1c1
Sequence:CCGGCCAAGCCATATTCTGTTGGATCTCGAGATCCAACAGAATATGGCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022369.2-899s1c1
Sequence:CCGGGAATATCTGAGGAACCTCCTTCTCGAGAAGGAGGTTCCTCAGATATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022369.2-607s1c1
Sequence:CCGGGTTCTATTATGCTGCCCTCTACTCGAGTAGAGGGCAGCATAATAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022369.2-745s1c1
Sequence:CCGGGCCCAAGATCTACAAGTACTACTCGAGTAGTACTTGTAGATCTTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022369.2-1848s1c1
Sequence:CCGGCGTACCGAAACTTCTTGAAGACTCGAGTCTTCAAGAAGTTTCGGTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022369
STRA6 MISSION shRNA Lentiviral Transduction Particles
stimulated by retinoic acid 6
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000439936    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022369.3-223s21c1
Sequence:CCGGCCACAGAGGACTACTCCTATGCTCGAGCATAGGAGTAGTCCTCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437537    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022369.3-1339s21c1
Sequence:CCGGTGACACACAGGACCAACCTTCCTCGAGGAAGGTTGGTCCTGTGTGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437368    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022369.3-1262s21c1
Sequence:CCGGGGCTCTGGAAGTGTGCTACATCTCGAGATGTAGCACACTTCCAGAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022369.3-1046s21c1
Sequence:CCGGAGGATTCCATCTCCCGCTGAACTCGAGTTCAGCGGGAGATGGAATCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184033    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022369.2-589s1c1
Sequence:CCGGCTGGAAGATACTGGGACTGTTCTCGAGAACAGTCCCAGTATCTTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179804    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022369.2-1396s1c1
Sequence:CCGGCCAAGCCATATTCTGTTGGATCTCGAGATCCAACAGAATATGGCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022369.2-899s1c1
Sequence:CCGGGAATATCTGAGGAACCTCCTTCTCGAGAAGGAGGTTCCTCAGATATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129158    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022369.2-607s1c1
Sequence:CCGGGTTCTATTATGCTGCCCTCTACTCGAGTAGAGGGCAGCATAATAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022369.2-745s1c1
Sequence:CCGGGCCCAAGATCTACAAGTACTACTCGAGTAGTACTTGTAGATCTTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128799    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022369.2-1848s1c1
Sequence:CCGGCGTACCGAAACTTCTTGAAGACTCGAGTCTTCAAGAAGTTTCGGTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009291
STRA6 MISSION shRNA Bacterial Glycerol Stock
stimulated by retinoic acid 6
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000314290    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009291.1-2585s21c1
Sequence:CCGGGAAAGCAGCTAGTGGTTTCTTCTCGAGAAGAAACCACTAGCTGCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314289    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009291.1-1091s21c1
Sequence:CCGGGAGAAGTATCTGAGAACTCTTCTCGAGAAGAGTTCTCAGATACTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009291.1-1010s21c1
Sequence:CCGGCTTTGGTATCCAGTACAACTTCTCGAGAAGTTGTACTGGATACCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009291.1-803s21c1
Sequence:CCGGCTCTACTATCCAGCCCTCTATCTCGAGATAGAGGGCTGGATAGTAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173499    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009291.1-2585s1c1
Sequence:CCGGGAAAGCAGCTAGTGGTTTCTTCTCGAGAAGAAACCACTAGCTGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009291.1-1091s1c1
Sequence:CCGGGAGAAGTATCTGAGAACTCTTCTCGAGAAGAGTTCTCAGATACTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009291.1-803s1c1
Sequence:CCGGCTCTACTATCCAGCCCTCTATCTCGAGATAGAGGGCTGGATAGTAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009291.1-1010s1c1
Sequence:CCGGCTTTGGTATCCAGTACAACTTCTCGAGAAGTTGTACTGGATACCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009291
STRA6 MISSION shRNA shRNA Plasmid DNA
stimulated by retinoic acid 6
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000314290    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009291.1-2585s21c1
Sequence:CCGGGAAAGCAGCTAGTGGTTTCTTCTCGAGAAGAAACCACTAGCTGCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314289    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009291.1-1091s21c1
Sequence:CCGGGAGAAGTATCTGAGAACTCTTCTCGAGAAGAGTTCTCAGATACTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009291.1-1010s21c1
Sequence:CCGGCTTTGGTATCCAGTACAACTTCTCGAGAAGTTGTACTGGATACCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009291.1-803s21c1
Sequence:CCGGCTCTACTATCCAGCCCTCTATCTCGAGATAGAGGGCTGGATAGTAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173499    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009291.1-2585s1c1
Sequence:CCGGGAAAGCAGCTAGTGGTTTCTTCTCGAGAAGAAACCACTAGCTGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009291.1-1091s1c1
Sequence:CCGGGAGAAGTATCTGAGAACTCTTCTCGAGAAGAGTTCTCAGATACTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009291.1-803s1c1
Sequence:CCGGCTCTACTATCCAGCCCTCTATCTCGAGATAGAGGGCTGGATAGTAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009291.1-1010s1c1
Sequence:CCGGCTTTGGTATCCAGTACAACTTCTCGAGAAGTTGTACTGGATACCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009291
STRA6 MISSION shRNA Lentiviral Transduction Particles
stimulated by retinoic acid 6
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000314290    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009291.1-2585s21c1
Sequence:CCGGGAAAGCAGCTAGTGGTTTCTTCTCGAGAAGAAACCACTAGCTGCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314289    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009291.1-1091s21c1
Sequence:CCGGGAGAAGTATCTGAGAACTCTTCTCGAGAAGAGTTCTCAGATACTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314351    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009291.1-1010s21c1
Sequence:CCGGCTTTGGTATCCAGTACAACTTCTCGAGAAGTTGTACTGGATACCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314350    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009291.1-803s21c1
Sequence:CCGGCTCTACTATCCAGCCCTCTATCTCGAGATAGAGGGCTGGATAGTAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173499    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009291.1-2585s1c1
Sequence:CCGGGAAAGCAGCTAGTGGTTTCTTCTCGAGAAGAAACCACTAGCTGCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009291.1-1091s1c1
Sequence:CCGGGAGAAGTATCTGAGAACTCTTCTCGAGAAGAGTTCTCAGATACTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009291.1-803s1c1
Sequence:CCGGCTCTACTATCCAGCCCTCTATCTCGAGATAGAGGGCTGGATAGTAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009291.1-1010s1c1
Sequence:CCGGCTTTGGTATCCAGTACAACTTCTCGAGAAGTTGTACTGGATACCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks