EMAIL THIS PAGE TO A FRIEND

STRA8

stimulated by retinoic acid 8

UniProtKB ID: Q7Z7C7
Gene ID:
Human(346673) Summary: This gene encodes a retinoic acid-responsive protein. A homologous protein in mouse has been shown to be involved in the regulation of meiotic initiation in both spermatogenesis and oogenesis, though feature differences between the mouse and human proteins suggest that these homologs are not entirely functionally equivalent. It is thought that this gene may play a role in spermatogenesis in humans. [provided by RefSeq, Nov 2010]
Mouse(20899) stimulated by retinoic acid gene 8
Rat(500079) stimulated by retinoic acid 8
chicken(417938) stimulated by retinoic acid gene 8 homolog (mouse)
domestic cat(101098856) stimulated by retinoic acid gene 8 homolog (mouse)
dog(610269) stimulated by retinoic acid gene 8 homolog (mouse)
cow(785714) stimulated by retinoic acid 8
sheep(101122594) stimulated by retinoic acid 8 homolog (mouse)
naked mole-rat(101710575) stimulated by retinoic acid 8
domestic guinea pig(100724406) stimulated by retinoic acid 8
51 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_182489 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_182489 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_182489 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009292 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009292 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009292 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU058121 MISSION® esiRNA esiRNA targeting mouse Stra8 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_182489 Rosetta Predictions human pricing
XM_001067836 Rosetta Predictions rat pricing
XM_575429 Rosetta Predictions rat pricing
NM_009292 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182489 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00035956 predicted 290
2 SASI_Hs01_00035957 predicted 255
3 SASI_Hs01_00035958 predicted 217
4 SASI_Hs01_00035959 predicted 310
5 SASI_Hs01_00035960 predicted 365
6 SASI_Hs02_00370527 predicted 548
7 SASI_Hs01_00035961 predicted 748
8 SASI_Hs01_00035962 predicted 218
9 SASI_Hs01_00035964 predicted 272
10 SASI_Hs01_00035965 predicted 360
11 SASI_Hs01_00035963 predicted 229
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001067836 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00322503 predicted 207
2 SASI_Rn02_00322504 predicted 760
3 SASI_Rn02_00322505 predicted 832
4 SASI_Rn02_00322506 predicted 866
5 SASI_Rn02_00322507 predicted 845
6 SASI_Rn02_00322508 predicted 205
7 SASI_Rn02_00322509 predicted 195
8 SASI_Rn02_00322510 predicted 870
9 SASI_Rn02_00322511 predicted 837
10 SASI_Rn02_00322512 predicted 731
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_575429 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00403666 predicted 209
2 SASI_Rn02_00403667 predicted 763
3 SASI_Rn02_00403668 predicted 830
4 SASI_Rn02_00403669 predicted 872
5 SASI_Rn02_00403670 predicted 845
6 SASI_Rn02_00403671 predicted 209
7 SASI_Rn02_00403672 predicted 201
8 SASI_Rn02_00403673 predicted 866
9 SASI_Rn02_00403674 predicted 837
10 SASI_Rn02_00403675 predicted 736
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009292 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00315806 predicted 1079
2 SASI_Mm02_00315807 predicted 1137
3 SASI_Mm02_00315808 predicted 286
4 SASI_Mm02_00315809 predicted 301
5 SASI_Mm02_00315810 predicted 1095
6 SASI_Mm02_00315811 predicted 1150
7 SASI_Mm02_00315812 predicted 1135
8 SASI_Mm02_00315813 predicted 1102
9 SASI_Mm02_00315814 predicted 1184
10 SASI_Mm02_00315815 predicted 1155
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182489
STRA8 MISSION shRNA Bacterial Glycerol Stock
stimulated by retinoic acid 8
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182489.1-282s1c1
Sequence:CCGGGAGTCATATTCCAGAACTGGACTCGAGTCCAGTTCTGGAATATGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182489.1-324s1c1
Sequence:CCGGGAAGCTGAAAGCATCCTTCAACTCGAGTTGAAGGATGCTTTCAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182489.1-384s1c1
Sequence:CCGGGAAAGAATATGCCAGCATGTACTCGAGTACATGCTGGCATATTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182489.1-334s1c1
Sequence:CCGGGCATCCTTCAACCTGGAAGATCTCGAGATCTTCCAGGTTGAAGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182489.1-286s1c1
Sequence:CCGGCATATTCCAGAACTGGAGCAACTCGAGTTGCTCCAGTTCTGGAATATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182489.1-230s21c1
Sequence:CCGGACTCTCAGTCTGATCTCATAGCTCGAGCTATGAGATCAGACTGAGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182489.1-894s21c1
Sequence:CCGGCTGTGCAAACACTCAAGTAAACTCGAGTTTACTTGAGTGTTTGCACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182489
STRA8 MISSION shRNA shRNA Plasmid DNA
stimulated by retinoic acid 8
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182489.1-282s1c1
Sequence:CCGGGAGTCATATTCCAGAACTGGACTCGAGTCCAGTTCTGGAATATGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182489.1-324s1c1
Sequence:CCGGGAAGCTGAAAGCATCCTTCAACTCGAGTTGAAGGATGCTTTCAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182489.1-384s1c1
Sequence:CCGGGAAAGAATATGCCAGCATGTACTCGAGTACATGCTGGCATATTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182489.1-334s1c1
Sequence:CCGGGCATCCTTCAACCTGGAAGATCTCGAGATCTTCCAGGTTGAAGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182489.1-286s1c1
Sequence:CCGGCATATTCCAGAACTGGAGCAACTCGAGTTGCTCCAGTTCTGGAATATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182489.1-230s21c1
Sequence:CCGGACTCTCAGTCTGATCTCATAGCTCGAGCTATGAGATCAGACTGAGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182489.1-894s21c1
Sequence:CCGGCTGTGCAAACACTCAAGTAAACTCGAGTTTACTTGAGTGTTTGCACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182489
STRA8 MISSION shRNA Lentiviral Transduction Particles
stimulated by retinoic acid 8
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182489.1-282s1c1
Sequence:CCGGGAGTCATATTCCAGAACTGGACTCGAGTCCAGTTCTGGAATATGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182489.1-324s1c1
Sequence:CCGGGAAGCTGAAAGCATCCTTCAACTCGAGTTGAAGGATGCTTTCAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182489.1-384s1c1
Sequence:CCGGGAAAGAATATGCCAGCATGTACTCGAGTACATGCTGGCATATTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127825    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182489.1-334s1c1
Sequence:CCGGGCATCCTTCAACCTGGAAGATCTCGAGATCTTCCAGGTTGAAGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182489.1-286s1c1
Sequence:CCGGCATATTCCAGAACTGGAGCAACTCGAGTTGCTCCAGTTCTGGAATATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435498    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182489.1-230s21c1
Sequence:CCGGACTCTCAGTCTGATCTCATAGCTCGAGCTATGAGATCAGACTGAGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416260    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182489.1-894s21c1
Sequence:CCGGCTGTGCAAACACTCAAGTAAACTCGAGTTTACTTGAGTGTTTGCACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009292
STRA8 MISSION shRNA Bacterial Glycerol Stock
stimulated by retinoic acid 8
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000198820    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009292.1-443s1c1
Sequence:CCGGCGAGAATGACAGTGTATTCCTCTCGAGAGGAATACACTGTCATTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009292.1-720s1c1
Sequence:CCGGCCGGACCTCATGGAATTTGAACTCGAGTTCAAATTCCATGAGGTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009292.1-1189s1c1
Sequence:CCGGGCTGTGTTAACACTCCATTAACTCGAGTTAATGGAGTGTTAACACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009292.1-1149s1c1
Sequence:CCGGCAGCTCTACATACAGATCATTCTCGAGAATGATCTGTATGTAGAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009292.1-359s1c1
Sequence:CCGGGAAGCTCAAAGCATCCTTCAACTCGAGTTGAAGGATGCTTTGAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182007    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009292.1-1295s1c1
Sequence:CCGGCGGAGAAGGAGGAGATTAAATCTCGAGATTTAATCTCCTCCTTCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215386    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009292.1-804s1c1
Sequence:CCGGCATGAAGTGACACTTCCTATTCTCGAGAATAGGAAGTGTCACTTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216621    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009292.1-305s1c1
Sequence:CCGGGAATAGGACAAAGATTCATATCTCGAGATATGAATCTTTGTCCTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217050    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009292.1-1093s1c1
Sequence:CCGGCTAACATCAGCGCTATGTTTGCTCGAGCAAACATAGCGCTGATGTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009292
STRA8 MISSION shRNA shRNA Plasmid DNA
stimulated by retinoic acid 8
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000198820    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009292.1-443s1c1
Sequence:CCGGCGAGAATGACAGTGTATTCCTCTCGAGAGGAATACACTGTCATTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009292.1-720s1c1
Sequence:CCGGCCGGACCTCATGGAATTTGAACTCGAGTTCAAATTCCATGAGGTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009292.1-1189s1c1
Sequence:CCGGGCTGTGTTAACACTCCATTAACTCGAGTTAATGGAGTGTTAACACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009292.1-1149s1c1
Sequence:CCGGCAGCTCTACATACAGATCATTCTCGAGAATGATCTGTATGTAGAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009292.1-359s1c1
Sequence:CCGGGAAGCTCAAAGCATCCTTCAACTCGAGTTGAAGGATGCTTTGAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182007    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009292.1-1295s1c1
Sequence:CCGGCGGAGAAGGAGGAGATTAAATCTCGAGATTTAATCTCCTCCTTCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215386    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009292.1-804s1c1
Sequence:CCGGCATGAAGTGACACTTCCTATTCTCGAGAATAGGAAGTGTCACTTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216621    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009292.1-305s1c1
Sequence:CCGGGAATAGGACAAAGATTCATATCTCGAGATATGAATCTTTGTCCTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217050    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009292.1-1093s1c1
Sequence:CCGGCTAACATCAGCGCTATGTTTGCTCGAGCAAACATAGCGCTGATGTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009292
STRA8 MISSION shRNA Lentiviral Transduction Particles
stimulated by retinoic acid 8
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000198820    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009292.1-443s1c1
Sequence:CCGGCGAGAATGACAGTGTATTCCTCTCGAGAGGAATACACTGTCATTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182159    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009292.1-720s1c1
Sequence:CCGGCCGGACCTCATGGAATTTGAACTCGAGTTCAAATTCCATGAGGTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178313    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009292.1-1189s1c1
Sequence:CCGGGCTGTGTTAACACTCCATTAACTCGAGTTAATGGAGTGTTAACACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009292.1-1149s1c1
Sequence:CCGGCAGCTCTACATACAGATCATTCTCGAGAATGATCTGTATGTAGAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181621    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009292.1-359s1c1
Sequence:CCGGGAAGCTCAAAGCATCCTTCAACTCGAGTTGAAGGATGCTTTGAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182007    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009292.1-1295s1c1
Sequence:CCGGCGGAGAAGGAGGAGATTAAATCTCGAGATTTAATCTCCTCCTTCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215386    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009292.1-804s1c1
Sequence:CCGGCATGAAGTGACACTTCCTATTCTCGAGAATAGGAAGTGTCACTTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216621    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009292.1-305s1c1
Sequence:CCGGGAATAGGACAAAGATTCATATCTCGAGATATGAATCTTTGTCCTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217050    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009292.1-1093s1c1
Sequence:CCGGCTAACATCAGCGCTATGTTTGCTCGAGCAAACATAGCGCTGATGTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks