EMAIL THIS PAGE TO A FRIEND

STRADA

STE20-related kinase adaptor alpha

Synonyms: LYK5 NY-BR-96 PMSE STRAD Stlk
Gene ID:
Human(92335) Summary: The protein encoded by this gene contains a STE20-like kinase domain, but lacks several residues that are critical for catalytic activity, so it is termed a 'pseudokinase'. The protein forms a heterotrimeric complex with serine/threonine kinase 11 (STK11, also known as LKB1) and the scaffolding protein calcium binding protein 39 (CAB39, also known as MO25). The protein activates STK11 leading to the phosphorylation of both proteins and excluding STK11 from the nucleus. The protein is necessary for STK11-induced G1 cell cycle arrest. A mutation in this gene has been shown to result in polyhydramnios, megalencephaly, and symptomatic epilepsy (PMSE) syndrome. Multiple transcript variants encoding different isoforms have been found for this gene. Additional transcript variants have been described but their full-length nature is not known. [provided by RefSeq, Sep 2009]
Mouse(72149) STE20-related kinase adaptor alpha
Rat(303605) STE20-related kinase adaptor alpha
domestic guinea pig(100732268) STE20-related kinase adaptor alpha
naked mole-rat(101707102) STE20-related kinase adaptor alpha
Domestic Rabbit(100348595) STE20-related kinase adaptor alpha
cow(515024) STE20-related kinase adaptor alpha
sheep(100302087) STE20-related kinase adaptor alpha
Zebrafish(334550) ste20-related kinase adaptor alpha
Horse(100064638) STE20-related kinase adaptor alpha
domestic cat(101095531) STE20-related kinase adaptor alpha
dog(609377) STE20-related kinase adaptor alpha
chicken(419957) STE20-related kinase adaptor alpha
111 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153335 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153335 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153335 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028126 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028126 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028126 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001003786 Rosetta Predictions human pricing
NM_001003787 Rosetta Predictions human pricing
NM_001003788 Rosetta Predictions human pricing
NM_153335 Rosetta Predictions human pricing
NM_182820 Rosetta Predictions rat pricing
NM_028126 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001003786 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00161425 predicted 749
2 SASI_Hs01_00161426 predicted 807
3 SASI_Hs01_00161427 predicted 806
4 SASI_Hs01_00161428 predicted 625
5 SASI_Hs01_00161429 predicted 1760
6 SASI_Hs01_00161430 predicted 1715
7 SASI_Hs01_00161431 predicted 1750
8 SASI_Hs01_00161432 predicted 1720
9 SASI_Hs01_00161433 predicted 794
10 SASI_Hs01_00161434 predicted 537
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001003787 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00062289 predicted 854
2 SASI_Hs01_00062290 predicted 917
3 SASI_Hs01_00062291 predicted 922
4 SASI_Hs01_00062292 predicted 739
5 SASI_Hs01_00062293 predicted 1878
6 SASI_Hs01_00062294 predicted 1832
7 SASI_Hs01_00062295 predicted 1858
8 SASI_Hs01_00062296 predicted 1830
9 SASI_Hs01_00062297 predicted 899
10 SASI_Hs01_00062298 predicted 654
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001003788 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00101707 predicted 830
2 SASI_Hs01_00101708 predicted 882
3 SASI_Hs01_00101709 predicted 886
4 SASI_Hs01_00101710 predicted 710
5 SASI_Hs01_00101711 predicted 1849
6 SASI_Hs01_00101712 predicted 1796
7 SASI_Hs01_00101713 predicted 1829
8 SASI_Hs01_00101714 predicted 1799
9 SASI_Hs01_00101715 predicted 878
10 SASI_Hs01_00101716 predicted 622
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153335 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00057433 predicted 749
2 SASI_Hs01_00057434 predicted 643
3 SASI_Hs01_00057435 predicted 803
4 SASI_Hs01_00057436 predicted 402
5 SASI_Hs01_00057437 predicted 658
6 SASI_Hs01_00057438 predicted 808
7 SASI_Hs01_00057439 predicted 807
8 SASI_Hs01_00057440 predicted 796
9 SASI_Hs01_00057441 predicted 677
10 SASI_Hs01_00057442 predicted 535
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182820 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00074935 predicted 771
2 SASI_Rn01_00074936 predicted 862
3 SASI_Rn01_00074937 predicted 755
4 SASI_Rn01_00074938 predicted 1234
5 SASI_Rn01_00074939 predicted 295
6 SASI_Rn01_00074940 predicted 248
7 SASI_Rn01_00074941 predicted 494
8 SASI_Rn01_00074942 predicted 267
9 SASI_Rn02_00269848 predicted 275
10 SASI_Rn01_00074943 predicted 514
11 SASI_Rn01_00074944 predicted 748
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028126 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00038282 predicted 263
2 SASI_Mm01_00038283 predicted 773
3 SASI_Mm01_00038284 predicted 547
4 SASI_Mm01_00038285 predicted 649
5 SASI_Mm01_00038286 predicted 297
6 SASI_Mm01_00038287 predicted 250
7 SASI_Mm02_00333383 predicted 493
8 SASI_Mm01_00038289 predicted 210
9 SASI_Mm01_00038290 predicted 323
10 SASI_Mm02_00333384 predicted 556
11 SASI_Mm01_00038288 predicted 499
12 SASI_Mm01_00038291 predicted 1187
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153335
VALIDATED
STRADA MISSION shRNA Bacterial Glycerol Stock
STE20-related kinase adaptor alpha
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000284822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_153335.4-336s21c1
Sequence:CCGGCGTGACTGTACGGAGGATTAACTCGAGTTAATCCTCCGTACAGTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000284826    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_153335.4-2023s21c1
Sequence:CCGGGCTGACTGATTGGGAAAGAAACTCGAGTTTCTTTCCCAATCAGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000284824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_153335.4-302s21c1
Sequence:CCGGTGAATCTAGCAAGGTACAAACCTCGAGGTTTGTACCTTGCTAGATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_153335.4-426s21c1
Sequence:CCGGCCATCCCAATATCGTGCCATACTCGAGTATGGCACGATATTGGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000272738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_153335.4-193s21c1
Sequence:CCGGTCAATAGCATCCTTCTCTAAACTCGAGTTTAGAGAAGGATGCTATTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200013    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153335.4-942s1c1
Sequence:CCGGCCTGTTGGATACCAGCACCATCTCGAGATGGTGCTGGTATCCAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_153335.4-750s1c1
Sequence:CCGGCAAGTACAGTGTCAAGGTTCTCTCGAGAGAACCTTGACACTGTACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_153335.4-693s1c1
Sequence:CCGGCAGCAACCTCAGCATGATAAGCTCGAGCTTATCATGCTGAGGTTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007047    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_153335.3-2138s1c1
Sequence:CCGGGCTGACTGATTGGGAAAGAAACTCGAGTTTCTTTCCCAATCAGTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007050    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_153335.3-911s1c1
Sequence:CCGGCAGCAGAATCTCCAGGGTTATCTCGAGATAACCCTGGAGATTCTGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007049    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_153335.3-451s1c1
Sequence:CCGGCGTGACTGTACGGAGGATTAACTCGAGTTAATCCTCCGTACAGTCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153335.3-379s1c1
Sequence:CCGGCACTGTGATAGGCAAAGGATTCTCGAGAATCCTTTGCCTATCACAGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153335
VALIDATED
STRADA MISSION shRNA shRNA Plasmid DNA
STE20-related kinase adaptor alpha
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000284822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_153335.4-336s21c1
Sequence:CCGGCGTGACTGTACGGAGGATTAACTCGAGTTAATCCTCCGTACAGTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000284826    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_153335.4-2023s21c1
Sequence:CCGGGCTGACTGATTGGGAAAGAAACTCGAGTTTCTTTCCCAATCAGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000284824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_153335.4-302s21c1
Sequence:CCGGTGAATCTAGCAAGGTACAAACCTCGAGGTTTGTACCTTGCTAGATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_153335.4-426s21c1
Sequence:CCGGCCATCCCAATATCGTGCCATACTCGAGTATGGCACGATATTGGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000272738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_153335.4-193s21c1
Sequence:CCGGTCAATAGCATCCTTCTCTAAACTCGAGTTTAGAGAAGGATGCTATTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200013    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153335.4-942s1c1
Sequence:CCGGCCTGTTGGATACCAGCACCATCTCGAGATGGTGCTGGTATCCAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_153335.4-750s1c1
Sequence:CCGGCAAGTACAGTGTCAAGGTTCTCTCGAGAGAACCTTGACACTGTACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_153335.4-693s1c1
Sequence:CCGGCAGCAACCTCAGCATGATAAGCTCGAGCTTATCATGCTGAGGTTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007047    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_153335.3-2138s1c1
Sequence:CCGGGCTGACTGATTGGGAAAGAAACTCGAGTTTCTTTCCCAATCAGTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007050    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_153335.3-911s1c1
Sequence:CCGGCAGCAGAATCTCCAGGGTTATCTCGAGATAACCCTGGAGATTCTGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007049    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_153335.3-451s1c1
Sequence:CCGGCGTGACTGTACGGAGGATTAACTCGAGTTAATCCTCCGTACAGTCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153335.3-379s1c1
Sequence:CCGGCACTGTGATAGGCAAAGGATTCTCGAGAATCCTTTGCCTATCACAGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153335
VALIDATED
STRADA MISSION shRNA Lentiviral Transduction Particles
STE20-related kinase adaptor alpha
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000284822    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_153335.4-336s21c1
Sequence:CCGGCGTGACTGTACGGAGGATTAACTCGAGTTAATCCTCCGTACAGTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000284826    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_153335.4-2023s21c1
Sequence:CCGGGCTGACTGATTGGGAAAGAAACTCGAGTTTCTTTCCCAATCAGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000284824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_153335.4-302s21c1
Sequence:CCGGTGAATCTAGCAAGGTACAAACCTCGAGGTTTGTACCTTGCTAGATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272728    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_153335.4-426s21c1
Sequence:CCGGCCATCCCAATATCGTGCCATACTCGAGTATGGCACGATATTGGGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000272738    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_153335.4-193s21c1
Sequence:CCGGTCAATAGCATCCTTCTCTAAACTCGAGTTTAGAGAAGGATGCTATTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200013    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153335.4-942s1c1
Sequence:CCGGCCTGTTGGATACCAGCACCATCTCGAGATGGTGCTGGTATCCAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_153335.4-750s1c1
Sequence:CCGGCAAGTACAGTGTCAAGGTTCTCTCGAGAGAACCTTGACACTGTACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195518    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_153335.4-693s1c1
Sequence:CCGGCAGCAACCTCAGCATGATAAGCTCGAGCTTATCATGCTGAGGTTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007047    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_153335.3-2138s1c1
Sequence:CCGGGCTGACTGATTGGGAAAGAAACTCGAGTTTCTTTCCCAATCAGTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007050    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_153335.3-911s1c1
Sequence:CCGGCAGCAGAATCTCCAGGGTTATCTCGAGATAACCCTGGAGATTCTGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007049    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_153335.3-451s1c1
Sequence:CCGGCGTGACTGTACGGAGGATTAACTCGAGTTAATCCTCCGTACAGTCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007051    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153335.3-379s1c1
Sequence:CCGGCACTGTGATAGGCAAAGGATTCTCGAGAATCCTTTGCCTATCACAGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028126
VALIDATED
STRADA MISSION shRNA Bacterial Glycerol Stock
STE20-related kinase adaptor alpha
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000276693    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028126.2-419s21c1
Sequence:CCGGGCCACCTTCATCGCAGATAATCTCGAGATTATCTGCGATGAAGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276696    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028126.2-1256s21c1
Sequence:CCGGATCTTCGGCCTGGTGACAAACCTCGAGGTTTGTCACCAGGCCGAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028126.2-660s21c1
Sequence:CCGGGCAGCAACCTTAGCATGATTACTCGAGTAATCATGCTAAGGTTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028126.2-270s21c1
Sequence:CCGGTGAATTTAGCCAGGTACAAACCTCGAGGTTTGTACCTGGCTAAATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276695    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028126.2-1775s21c1
Sequence:CCGGCTGAGCACCAGGTCAGTTAAGCTCGAGCTTAACTGACCTGGTGCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028126.1-420s1c1
Sequence:CCGGGCCACCTTCATCGCAGATAATCTCGAGATTATCTGCGATGAAGGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028126.1-395s1c1
Sequence:CCGGCCATCCCAATATAGTACCGTACTCGAGTACGGTACTATATTGGGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028126.1-868s1c1
Sequence:CCGGCCACTCAGATGCTGCTAGAAACTCGAGTTTCTAGCAGCATCTGAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028126.1-452s1c1
Sequence:CCGGCGTCACATCATTTATGGCGTACTCGAGTACGCCATAAATGATGTGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028126.1-661s1c1
Sequence:CCGGGCAGCAACCTTAGCATGATTACTCGAGTAATCATGCTAAGGTTGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028126
VALIDATED
STRADA MISSION shRNA shRNA Plasmid DNA
STE20-related kinase adaptor alpha
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000276693    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028126.2-419s21c1
Sequence:CCGGGCCACCTTCATCGCAGATAATCTCGAGATTATCTGCGATGAAGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276696    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028126.2-1256s21c1
Sequence:CCGGATCTTCGGCCTGGTGACAAACCTCGAGGTTTGTCACCAGGCCGAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028126.2-660s21c1
Sequence:CCGGGCAGCAACCTTAGCATGATTACTCGAGTAATCATGCTAAGGTTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028126.2-270s21c1
Sequence:CCGGTGAATTTAGCCAGGTACAAACCTCGAGGTTTGTACCTGGCTAAATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276695    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028126.2-1775s21c1
Sequence:CCGGCTGAGCACCAGGTCAGTTAAGCTCGAGCTTAACTGACCTGGTGCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028126.1-420s1c1
Sequence:CCGGGCCACCTTCATCGCAGATAATCTCGAGATTATCTGCGATGAAGGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028126.1-395s1c1
Sequence:CCGGCCATCCCAATATAGTACCGTACTCGAGTACGGTACTATATTGGGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028126.1-868s1c1
Sequence:CCGGCCACTCAGATGCTGCTAGAAACTCGAGTTTCTAGCAGCATCTGAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028126.1-452s1c1
Sequence:CCGGCGTCACATCATTTATGGCGTACTCGAGTACGCCATAAATGATGTGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028126.1-661s1c1
Sequence:CCGGGCAGCAACCTTAGCATGATTACTCGAGTAATCATGCTAAGGTTGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028126
VALIDATED
STRADA MISSION shRNA Lentiviral Transduction Particles
STE20-related kinase adaptor alpha
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000276693    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028126.2-419s21c1
Sequence:CCGGGCCACCTTCATCGCAGATAATCTCGAGATTATCTGCGATGAAGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276696    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028126.2-1256s21c1
Sequence:CCGGATCTTCGGCCTGGTGACAAACCTCGAGGTTTGTCACCAGGCCGAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276631    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028126.2-660s21c1
Sequence:CCGGGCAGCAACCTTAGCATGATTACTCGAGTAATCATGCTAAGGTTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276630    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028126.2-270s21c1
Sequence:CCGGTGAATTTAGCCAGGTACAAACCTCGAGGTTTGTACCTGGCTAAATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276695    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028126.2-1775s21c1
Sequence:CCGGCTGAGCACCAGGTCAGTTAAGCTCGAGCTTAACTGACCTGGTGCTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025329    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028126.1-420s1c1
Sequence:CCGGGCCACCTTCATCGCAGATAATCTCGAGATTATCTGCGATGAAGGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025333    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028126.1-395s1c1
Sequence:CCGGCCATCCCAATATAGTACCGTACTCGAGTACGGTACTATATTGGGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025332    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028126.1-868s1c1
Sequence:CCGGCCACTCAGATGCTGCTAGAAACTCGAGTTTCTAGCAGCATCTGAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025331    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028126.1-452s1c1
Sequence:CCGGCGTCACATCATTTATGGCGTACTCGAGTACGCCATAAATGATGTGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028126.1-661s1c1
Sequence:CCGGGCAGCAACCTTAGCATGATTACTCGAGTAATCATGCTAAGGTTGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks