EMAIL THIS PAGE TO A FRIEND

STRADB

STE20-related kinase adaptor beta

Synonyms: ALS2CR2 CALS-21 ILPIP ILPIPA PAPK
UniProtKB ID: Q9C0K7, Q5BKY7, Q9P1L0
Gene ID:
Human(55437) Summary: This gene encodes a protein that belongs to the serine/threonine protein kinase STE20 subfamily. One of the active site residues in the protein kinase domain of this protein is altered, and it is thus a pseudokinase. This protein is a component of a complex involved in the activation of serine/threonine kinase 11, a master kinase that regulates cell polarity and energy-generating metabolism. This complex regulates the relocation of this kinase from the nucleus to the cytoplasm, and it is essential for G1 cell cycle arrest mediated by this kinase. The protein encoded by this gene can also interact with the X chromosome-linked inhibitor of apoptosis protein, and this interaction enhances the anti-apoptotic activity of this protein via the JNK1 signal transduction pathway. Two pseudogenes, located on chromosomes 1 and 7, have been found for this gene. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2011]
Mouse(227154) STE20-related kinase adaptor beta
Rat(501146) STE20-related kinase adaptor beta
chicken(424083) STE20-related kinase adaptor beta
Horse(100066574) STE20-related kinase adaptor beta
domestic cat(101094615) STE20-related kinase adaptor beta
dog(478870) STE20-related kinase adaptor beta
cow(506029) STE20-related kinase adaptor beta
sheep(101108549) STE20-related kinase adaptor beta
Goat(100861151) STE20-related kinase adaptor beta
Domestic Rabbit(100342882) STE20-related kinase adaptor beta
naked mole-rat(101700434) STE20-related kinase adaptor beta
domestic guinea pig(100712796) STE20-related kinase adaptor beta
Gene Class: Cytoskeleton
112 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172656 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172656 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172656 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018571 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018571 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018571 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018571 Rosetta Predictions human pricing
NM_001109307 Rosetta Predictions rat pricing
NM_172656 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018571 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00236061 predicted 1333
2 SASI_Hs01_00236062 predicted 533
3 SASI_Hs01_00236063 predicted 444
4 SASI_Hs02_00352119 predicted 1593
5 SASI_Hs01_00236064 predicted 771
6 SASI_Hs01_00236065 predicted 795
7 SASI_Hs01_00236066 predicted 780
8 SASI_Hs01_00236067 predicted 1634
9 SASI_Hs01_00236068 predicted 562
10 SASI_Hs01_00236069 predicted 1076
11 SASI_Hs01_00236070 predicted 1069
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109307 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00247134 predicted 1439
2 SASI_Rn02_00247135 predicted 1005
3 SASI_Rn02_00247136 predicted 1685
4 SASI_Rn02_00247137 predicted 820
5 SASI_Rn02_00247138 predicted 1105
6 SASI_Rn02_00247139 predicted 1170
7 SASI_Rn02_00247140 predicted 1572
8 SASI_Rn02_00247141 predicted 1071
9 SASI_Rn02_00247142 predicted 1606
10 SASI_Rn02_00247143 predicted 605
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172656 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00064988 predicted 1696
2 SASI_Mm01_00064989 predicted 457
3 SASI_Mm01_00064990 predicted 1116
4 SASI_Mm01_00064991 predicted 831
5 SASI_Mm01_00064992 predicted 1184
6 SASI_Mm01_00064993 predicted 780
7 SASI_Mm01_00064994 predicted 407
8 SASI_Mm01_00064995 predicted 910
9 SASI_Mm01_00064996 predicted 658
10 SASI_Mm01_00064997 predicted 577
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172656
STRADB MISSION shRNA Bacterial Glycerol Stock
STE20-related kinase adaptor beta
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000025339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172656.3-658s1c1
Sequence:CCGGGCAGTGATTCTATCTCACTTTCTCGAGAAAGTGAGATAGAATCACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172656.3-1438s1c1
Sequence:CCGGGTATTCTTCAAGCAGATGAAACTCGAGTTTCATCTGCTTGAAGAATACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172656.3-1417s1c1
Sequence:CCGGGCAAGCAGTTTGTTGTCCCATCTCGAGATGGGACAACAAACTGCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172656.3-951s1c1
Sequence:CCGGCCACCTGCATAGTTTGCTTAACTCGAGTTAAGCAAACTATGCAGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000025340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172656.3-1199s1c1
Sequence:CCGGGCCCACTGGATGTCAGTATTTCTCGAGAAATACTGACATCCAGTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172656.5-1093s21c1
Sequence:CCGGCAGGATTTACATGGATATAATCTCGAGATTATATCCATGTAAATCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362168    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172656.5-1690s21c1
Sequence:CCGGTCGGTCCTGTTAGGTACAAATCTCGAGATTTGTACCTAACAGGACCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362167    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172656.5-1905s21c1
Sequence:CCGGTAAGCTGTGACTGGTACTTTCCTCGAGGAAAGTACCAGTCACAGCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172656.5-812s21c1
Sequence:CCGGAGCTCCTAAGGACCTACTTTCCTCGAGGAAAGTAGGTCCTTAGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172656
STRADB MISSION shRNA shRNA Plasmid DNA
STE20-related kinase adaptor beta
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000025339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172656.3-658s1c1
Sequence:CCGGGCAGTGATTCTATCTCACTTTCTCGAGAAAGTGAGATAGAATCACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172656.3-1438s1c1
Sequence:CCGGGTATTCTTCAAGCAGATGAAACTCGAGTTTCATCTGCTTGAAGAATACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172656.3-1417s1c1
Sequence:CCGGGCAAGCAGTTTGTTGTCCCATCTCGAGATGGGACAACAAACTGCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172656.3-951s1c1
Sequence:CCGGCCACCTGCATAGTTTGCTTAACTCGAGTTAAGCAAACTATGCAGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000025340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172656.3-1199s1c1
Sequence:CCGGGCCCACTGGATGTCAGTATTTCTCGAGAAATACTGACATCCAGTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172656.5-1093s21c1
Sequence:CCGGCAGGATTTACATGGATATAATCTCGAGATTATATCCATGTAAATCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362168    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172656.5-1690s21c1
Sequence:CCGGTCGGTCCTGTTAGGTACAAATCTCGAGATTTGTACCTAACAGGACCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362167    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172656.5-1905s21c1
Sequence:CCGGTAAGCTGTGACTGGTACTTTCCTCGAGGAAAGTACCAGTCACAGCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172656.5-812s21c1
Sequence:CCGGAGCTCCTAAGGACCTACTTTCCTCGAGGAAAGTAGGTCCTTAGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172656
STRADB MISSION shRNA Lentiviral Transduction Particles
STE20-related kinase adaptor beta
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000025339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172656.3-658s1c1
Sequence:CCGGGCAGTGATTCTATCTCACTTTCTCGAGAAAGTGAGATAGAATCACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172656.3-1438s1c1
Sequence:CCGGGTATTCTTCAAGCAGATGAAACTCGAGTTTCATCTGCTTGAAGAATACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025343    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172656.3-1417s1c1
Sequence:CCGGGCAAGCAGTTTGTTGTCCCATCTCGAGATGGGACAACAAACTGCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172656.3-951s1c1
Sequence:CCGGCCACCTGCATAGTTTGCTTAACTCGAGTTAAGCAAACTATGCAGGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000025340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172656.3-1199s1c1
Sequence:CCGGGCCCACTGGATGTCAGTATTTCTCGAGAAATACTGACATCCAGTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172656.5-1093s21c1
Sequence:CCGGCAGGATTTACATGGATATAATCTCGAGATTATATCCATGTAAATCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362168    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172656.5-1690s21c1
Sequence:CCGGTCGGTCCTGTTAGGTACAAATCTCGAGATTTGTACCTAACAGGACCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362167    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172656.5-1905s21c1
Sequence:CCGGTAAGCTGTGACTGGTACTTTCCTCGAGGAAAGTACCAGTCACAGCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362165    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172656.5-812s21c1
Sequence:CCGGAGCTCCTAAGGACCTACTTTCCTCGAGGAAAGTAGGTCCTTAGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018571
VALIDATED
STRADB MISSION shRNA Bacterial Glycerol Stock
STE20-related kinase adaptor beta
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000007075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018571.4-1215s1c1
Sequence:CCGGCCTCCTTATAGCCCATTGGATCTCGAGATCCAATGGGCTATAAGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007072    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A3
TRC Version: 1 Clone ID:NM_018571.4-1732s1c1
Sequence:CCGGGCACTGGAGAATCTATTATTTCTCGAGAAATAATAGATTCTCCAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007073    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A3
TRC Version: 1 Clone ID:NM_018571.4-1321s1c1
Sequence:CCGGCCAGTGGAACTCACACAGTAACTCGAGTTACTGTGTGAGTTCCACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007076    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018571.4-758s1c1
Sequence:CCGGGCTTTGGGTTATTTCTCCATTCTCGAGAATGGAGAAATAACCCAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007074    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018571.4-684s1c1
Sequence:CCGGGCCGTGATTCTATCCCACTTTCTCGAGAAAGTGGGATAGAATCACGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_018571.4-435s1c1
Sequence:CCGGGAAACCAGTATCCATCAATACCTCGAGGTATTGATGGATACTGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196530    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_018571.4-397s1c1
Sequence:CCGGGAACACAAGTTGAATCACTCACTCGAGTGAGTGATTCAACTTGTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195094    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_018571.4-1835s1c1
Sequence:CCGGCTAATCTAGCTAGTGTCATTTCTCGAGAAATGACACTAGCTAGATTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194701    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_018571.4-1803s1c1
Sequence:CCGGCAGAGTACTATGACAAGGAAACTCGAGTTTCCTTGTCATAGTACTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018571.5-611s21c1
Sequence:CCGGAGGAACACTGGTAACTATAAACTCGAGTTTATAGTTACCAGTGTTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018571
VALIDATED
STRADB MISSION shRNA shRNA Plasmid DNA
STE20-related kinase adaptor beta
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000007075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018571.4-1215s1c1
Sequence:CCGGCCTCCTTATAGCCCATTGGATCTCGAGATCCAATGGGCTATAAGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007072    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A3
TRC Version: 1 Clone ID:NM_018571.4-1732s1c1
Sequence:CCGGGCACTGGAGAATCTATTATTTCTCGAGAAATAATAGATTCTCCAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007073    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A3
TRC Version: 1 Clone ID:NM_018571.4-1321s1c1
Sequence:CCGGCCAGTGGAACTCACACAGTAACTCGAGTTACTGTGTGAGTTCCACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007076    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018571.4-758s1c1
Sequence:CCGGGCTTTGGGTTATTTCTCCATTCTCGAGAATGGAGAAATAACCCAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007074    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018571.4-684s1c1
Sequence:CCGGGCCGTGATTCTATCCCACTTTCTCGAGAAAGTGGGATAGAATCACGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_018571.4-435s1c1
Sequence:CCGGGAAACCAGTATCCATCAATACCTCGAGGTATTGATGGATACTGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196530    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_018571.4-397s1c1
Sequence:CCGGGAACACAAGTTGAATCACTCACTCGAGTGAGTGATTCAACTTGTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195094    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_018571.4-1835s1c1
Sequence:CCGGCTAATCTAGCTAGTGTCATTTCTCGAGAAATGACACTAGCTAGATTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194701    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_018571.4-1803s1c1
Sequence:CCGGCAGAGTACTATGACAAGGAAACTCGAGTTTCCTTGTCATAGTACTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018571.5-611s21c1
Sequence:CCGGAGGAACACTGGTAACTATAAACTCGAGTTTATAGTTACCAGTGTTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018571
VALIDATED
STRADB MISSION shRNA Lentiviral Transduction Particles
STE20-related kinase adaptor beta
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000007075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018571.4-1215s1c1
Sequence:CCGGCCTCCTTATAGCCCATTGGATCTCGAGATCCAATGGGCTATAAGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007072    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A3
TRC Version: 1 Clone ID:NM_018571.4-1732s1c1
Sequence:CCGGGCACTGGAGAATCTATTATTTCTCGAGAAATAATAGATTCTCCAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007073    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A3
TRC Version: 1 Clone ID:NM_018571.4-1321s1c1
Sequence:CCGGCCAGTGGAACTCACACAGTAACTCGAGTTACTGTGTGAGTTCCACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007076    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018571.4-758s1c1
Sequence:CCGGGCTTTGGGTTATTTCTCCATTCTCGAGAATGGAGAAATAACCCAAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007074    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_018571.4-684s1c1
Sequence:CCGGGCCGTGATTCTATCCCACTTTCTCGAGAAAGTGGGATAGAATCACGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_018571.4-435s1c1
Sequence:CCGGGAAACCAGTATCCATCAATACCTCGAGGTATTGATGGATACTGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196530    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_018571.4-397s1c1
Sequence:CCGGGAACACAAGTTGAATCACTCACTCGAGTGAGTGATTCAACTTGTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195094    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_018571.4-1835s1c1
Sequence:CCGGCTAATCTAGCTAGTGTCATTTCTCGAGAAATGACACTAGCTAGATTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194701    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A3
TRC Version: 1.5 Clone ID:NM_018571.4-1803s1c1
Sequence:CCGGCAGAGTACTATGACAAGGAAACTCGAGTTTCCTTGTCATAGTACTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018571.5-611s21c1
Sequence:CCGGAGGAACACTGGTAACTATAAACTCGAGTTTATAGTTACCAGTGTTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks