EMAIL THIS PAGE TO A FRIEND

STRAP

serine/threonine kinase receptor associated protein

Synonyms: MAWD PT-WD UNRIP
UniProtKB ID: Q9Y3F4, B2R5S5, Q5TZT4, Q9NTK0, Q9UQC8
Gene ID:
Mouse(20901) serine/threonine kinase receptor associated protein
Rat(297699) serine/threonine kinase receptor associated protein
Zebrafish(393274) serine/threonine kinase receptor associated protein
chicken(418175) serine/threonine kinase receptor associated protein
domestic cat(101098801) serine/threonine kinase receptor associated protein
dog(486663) serine/threonine kinase receptor associated protein
domestic guinea pig(100735928) serine/threonine kinase receptor associated protein
naked mole-rat(101714838) serine/threonine kinase receptor associated protein
cow(510201) serine/threonine kinase receptor associated protein
sheep(101104225) serine/threonine kinase receptor associated protein
67 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV48038 Anti-STRAP (AB1) antibody produced in rabbit affinity isolated antibody , rat, guinea pig, canine, human, bovine, zebrafish, mouse, rabbit, horse
immunohistochemistry, western blot pricing
AV48039 Anti-STRAP (AB2) antibody produced in rabbit IgG fraction of antiserum rat, guinea pig, bovine, human, canine, horse, mouse, rabbit
western blot pricing
HPA027320 Anti-STRAP antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human, mouse, rat
immunohistochemistry, western blot pricing
HPA055557 Anti-STRAP antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB2702103 Anti-STRAP antibody produced in rabbit human
immunocytochemistry, immunofluorescence, immunohistochemistry, western blot pricing
HPA073876 Anti-STRAP antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007178 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007178 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007178 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011499 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011499 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011499 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007178 Rosetta Predictions human pricing
NM_001011969 Rosetta Predictions rat pricing
XM_575708 Rosetta Predictions rat pricing
NM_011499 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007178 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00016956 predicted 1423
2 SASI_Hs01_00016957 predicted 1403
3 SASI_Hs02_00343131 predicted 867
4 SASI_Hs02_00343132 predicted 426
5 SASI_Hs01_00016958 predicted 899
6 SASI_Hs02_00343133 predicted 861
7 SASI_Hs02_00343134 predicted 1139
8 SASI_Hs02_00343135 predicted 944
9 SASI_Hs02_00343136 predicted 708
10 SASI_Hs01_00016960 predicted 554
11 SASI_Hs01_00016959 predicted 1359
12 SASI_Hs01_00016961 predicted 384
13 SASI_Hs01_00016962 predicted 1340
14 SASI_Hs01_00016963 predicted 1445
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001011969 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00065774 predicted 786
2 SASI_Rn01_00065776 predicted 835
3 SASI_Rn01_00065777 predicted 934
4 SASI_Rn01_00065779 predicted 870
5 SASI_Rn02_00199990 predicted 1015
6 SASI_Rn01_00065780 predicted 704
7 SASI_Rn01_00065781 predicted 925
8 SASI_Rn01_00065782 predicted 716
9 SASI_Rn01_00065783 predicted 1196
10 SASI_Rn02_00199991 predicted 969
11 SASI_Rn01_00065775 predicted 1193
12 SASI_Rn01_00065778 predicted 413
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_575708 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00132994 predicted 796
2 SASI_Rn01_00132995 predicted 1201
3 SASI_Rn01_00132996 predicted 839
4 SASI_Rn01_00132997 predicted 935
5 SASI_Rn01_00132998 predicted 422
6 SASI_Rn01_00132999 predicted 882
7 SASI_Rn01_00133000 predicted 711
8 SASI_Rn01_00133001 predicted 933
9 SASI_Rn01_00133002 predicted 725
10 SASI_Rn01_00133003 predicted 1204
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011499 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00067883 predicted 580
2 SASI_Mm01_00067884 predicted 1054
3 SASI_Mm01_00067885 predicted 504
4 SASI_Mm01_00067886 predicted 479
5 SASI_Mm01_00067887 predicted 1279
6 SASI_Mm01_00067888 predicted 1346
7 SASI_Mm01_00067889 predicted 770
8 SASI_Mm01_00067891 predicted 864
9 SASI_Mm01_00067892 predicted 1065
10 SASI_Mm02_00320809 predicted 628
11 SASI_Mm01_00067890 predicted 853
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007178
VALIDATED
STRAP MISSION shRNA Bacterial Glycerol Stock
serine/threonine kinase receptor associated protein
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000425074    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007178.3-1659s21c1
Sequence:CCGGTACAAGCCAACATCCAATTTCCTCGAGGAAATTGGATGTTGGCTTGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424480    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007178.3-1541s21c1
Sequence:CCGGGTGCTGGAACAACTAACTAACCTCGAGGTTAGTTAGTTGTTCCAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421807    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007178.3-1622s21c1
Sequence:CCGGTATAGTACAGTGGCCTGTTATCTCGAGATAACAGGCCACTGTACTATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007178.2-463s1c1
Sequence:CCGGTGGGTCATAAAGGTGCTGTTTCTCGAGAAACAGCACCTTTATGACCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_007178.2-1095s1c1
Sequence:CCGGCCTATTCACTGTGTGAGATTTCTCGAGAAATCTCACACAGTGAATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007178.2-981s1c1
Sequence:CCGGGCATCTCTTCATCCTGAGAAACTCGAGTTTCTCAGGATGAAGAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060465    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_007178.2-690s1c1
Sequence:CCGGCCTGAAGCAGAACCTAAGGAACTCGAGTTCCTTAGGTTCTGCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007178.2-848s1c1
Sequence:CCGGGTCTGTTAGTAGTATGGAATACTCGAGTATTCCATACTACTAACAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007178
VALIDATED
STRAP MISSION shRNA shRNA Plasmid DNA
serine/threonine kinase receptor associated protein
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000425074    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007178.3-1659s21c1
Sequence:CCGGTACAAGCCAACATCCAATTTCCTCGAGGAAATTGGATGTTGGCTTGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424480    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007178.3-1541s21c1
Sequence:CCGGGTGCTGGAACAACTAACTAACCTCGAGGTTAGTTAGTTGTTCCAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421807    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007178.3-1622s21c1
Sequence:CCGGTATAGTACAGTGGCCTGTTATCTCGAGATAACAGGCCACTGTACTATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007178.2-463s1c1
Sequence:CCGGTGGGTCATAAAGGTGCTGTTTCTCGAGAAACAGCACCTTTATGACCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_007178.2-1095s1c1
Sequence:CCGGCCTATTCACTGTGTGAGATTTCTCGAGAAATCTCACACAGTGAATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007178.2-981s1c1
Sequence:CCGGGCATCTCTTCATCCTGAGAAACTCGAGTTTCTCAGGATGAAGAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060465    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_007178.2-690s1c1
Sequence:CCGGCCTGAAGCAGAACCTAAGGAACTCGAGTTCCTTAGGTTCTGCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007178.2-848s1c1
Sequence:CCGGGTCTGTTAGTAGTATGGAATACTCGAGTATTCCATACTACTAACAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007178
VALIDATED
STRAP MISSION shRNA Lentiviral Transduction Particles
serine/threonine kinase receptor associated protein
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000425074    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007178.3-1659s21c1
Sequence:CCGGTACAAGCCAACATCCAATTTCCTCGAGGAAATTGGATGTTGGCTTGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424480    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007178.3-1541s21c1
Sequence:CCGGGTGCTGGAACAACTAACTAACCTCGAGGTTAGTTAGTTGTTCCAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421807    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007178.3-1622s21c1
Sequence:CCGGTATAGTACAGTGGCCTGTTATCTCGAGATAACAGGCCACTGTACTATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007178.2-463s1c1
Sequence:CCGGTGGGTCATAAAGGTGCTGTTTCTCGAGAAACAGCACCTTTATGACCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_007178.2-1095s1c1
Sequence:CCGGCCTATTCACTGTGTGAGATTTCTCGAGAAATCTCACACAGTGAATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007178.2-981s1c1
Sequence:CCGGGCATCTCTTCATCCTGAGAAACTCGAGTTTCTCAGGATGAAGAGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060465    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_007178.2-690s1c1
Sequence:CCGGCCTGAAGCAGAACCTAAGGAACTCGAGTTCCTTAGGTTCTGCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007178.2-848s1c1
Sequence:CCGGGTCTGTTAGTAGTATGGAATACTCGAGTATTCCATACTACTAACAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011499
VALIDATED
STRAP MISSION shRNA Bacterial Glycerol Stock
serine/threonine kinase receptor associated protein
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000324154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011499.3-907s21c1
Sequence:CCGGGTAAGTCTGGAGCCAATTAAACTCGAGTTTAATTGGCTCCAGACTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011499.3-646s21c1
Sequence:CCGGCGCATATATGACTTGAACAAACTCGAGTTTGTTCAAGTCATATATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324155    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011499.3-1569s21c1
Sequence:CCGGGCCAACTTACAATCTCCATTTCTCGAGAAATGGAGATTGTAAGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000353910    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011499.3-1219s21c1
Sequence:CCGGGCAAAGCCAAAGATCGGATTTCTCGAGAAATCCGATCTTTGGCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088833    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011499.1-1384s1c1
Sequence:CCGGGCCAACTTACAATCTCCATTTCTCGAGAAATGGAGATTGTAAGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011499.1-458s1c1
Sequence:CCGGCGCATATATGACTTGAACAAACTCGAGTTTGTTCAAGTCATATATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011499.1-716s1c1
Sequence:CCGGGCAGTAAGTCTGGAGCCAATTCTCGAGAATTGGCTCCAGACTTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011499.1-719s1c1
Sequence:CCGGGTAAGTCTGGAGCCAATTAAACTCGAGTTTAATTGGCTCCAGACTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000088835    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011499.1-1031s1c1
Sequence:CCGGGCAAAGCCAAAGATCGGATTTCTCGAGAAATCCGATCTTTGGCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011499
VALIDATED
STRAP MISSION shRNA shRNA Plasmid DNA
serine/threonine kinase receptor associated protein
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000324154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011499.3-907s21c1
Sequence:CCGGGTAAGTCTGGAGCCAATTAAACTCGAGTTTAATTGGCTCCAGACTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011499.3-646s21c1
Sequence:CCGGCGCATATATGACTTGAACAAACTCGAGTTTGTTCAAGTCATATATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324155    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011499.3-1569s21c1
Sequence:CCGGGCCAACTTACAATCTCCATTTCTCGAGAAATGGAGATTGTAAGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000353910    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011499.3-1219s21c1
Sequence:CCGGGCAAAGCCAAAGATCGGATTTCTCGAGAAATCCGATCTTTGGCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088833    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011499.1-1384s1c1
Sequence:CCGGGCCAACTTACAATCTCCATTTCTCGAGAAATGGAGATTGTAAGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011499.1-458s1c1
Sequence:CCGGCGCATATATGACTTGAACAAACTCGAGTTTGTTCAAGTCATATATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011499.1-716s1c1
Sequence:CCGGGCAGTAAGTCTGGAGCCAATTCTCGAGAATTGGCTCCAGACTTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011499.1-719s1c1
Sequence:CCGGGTAAGTCTGGAGCCAATTAAACTCGAGTTTAATTGGCTCCAGACTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000088835    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011499.1-1031s1c1
Sequence:CCGGGCAAAGCCAAAGATCGGATTTCTCGAGAAATCCGATCTTTGGCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011499
VALIDATED
STRAP MISSION shRNA Lentiviral Transduction Particles
serine/threonine kinase receptor associated protein
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000324154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011499.3-907s21c1
Sequence:CCGGGTAAGTCTGGAGCCAATTAAACTCGAGTTTAATTGGCTCCAGACTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011499.3-646s21c1
Sequence:CCGGCGCATATATGACTTGAACAAACTCGAGTTTGTTCAAGTCATATATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324155    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011499.3-1569s21c1
Sequence:CCGGGCCAACTTACAATCTCCATTTCTCGAGAAATGGAGATTGTAAGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000353910    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011499.3-1219s21c1
Sequence:CCGGGCAAAGCCAAAGATCGGATTTCTCGAGAAATCCGATCTTTGGCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088833    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011499.1-1384s1c1
Sequence:CCGGGCCAACTTACAATCTCCATTTCTCGAGAAATGGAGATTGTAAGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088834    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011499.1-458s1c1
Sequence:CCGGCGCATATATGACTTGAACAAACTCGAGTTTGTTCAAGTCATATATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088836    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011499.1-716s1c1
Sequence:CCGGGCAGTAAGTCTGGAGCCAATTCTCGAGAATTGGCTCCAGACTTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088837    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011499.1-719s1c1
Sequence:CCGGGTAAGTCTGGAGCCAATTAAACTCGAGTTTAATTGGCTCCAGACTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000088835    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011499.1-1031s1c1
Sequence:CCGGGCAAAGCCAAAGATCGGATTTCTCGAGAAATCCGATCTTTGGCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks