EMAIL THIS PAGE TO A FRIEND

STRBP

spermatid perinuclear RNA binding protein

Synonyms: ILF3L SPNR p74
Gene ID:
Mouse(20744) spermatid perinuclear RNA binding protein
Rat(84476) spermatid perinuclear RNA binding protein
cow(516282) spermatid perinuclear RNA binding protein
sheep(101109426) spermatid perinuclear RNA binding protein
naked mole-rat(101723113) spermatid perinuclear RNA binding protein
Domestic Rabbit(100341724) spermatid perinuclear RNA binding protein
domestic guinea pig(100736212) spermatid perinuclear RNA binding protein
Zebrafish(557957) spermatid perinuclear RNA binding protein
dog(480733) spermatid perinuclear RNA binding protein
domestic cat(101080491) spermatid perinuclear RNA binding protein
Horse(100071069) spermatid perinuclear RNA binding protein
chicken(417105) spermatid perinuclear RNA binding protein
93 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018387 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018387 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018387 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009261 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009261 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009261 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018387 Rosetta Predictions human pricing
NM_053416 Rosetta Predictions rat pricing
NM_009261 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018387 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00067654 predicted 1965
2 SASI_Hs01_00067655 predicted 1924
3 SASI_Hs02_00351877 predicted 492
4 SASI_Hs01_00067657 predicted 987
5 SASI_Hs01_00067658 predicted 1171
6 SASI_Hs02_00351878 predicted 796
7 SASI_Hs01_00067659 predicted 1595
8 SASI_Hs01_00067660 predicted 1497
9 SASI_Hs01_00067661 predicted 505
10 SASI_Hs01_00067662 predicted 1857
11 SASI_Hs01_00067656 predicted 1305
12 SASI_Hs01_00067663 predicted 527
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053416 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00265942 predicted 723
2 SASI_Rn02_00265943 predicted 905
3 SASI_Rn01_00037351 predicted 2053
4 SASI_Rn01_00037353 predicted 392
5 SASI_Rn01_00037355 predicted 1234
6 SASI_Rn02_00265944 predicted 201
7 SASI_Rn02_00265945 predicted 1046
8 SASI_Rn01_00037356 predicted 1920
9 SASI_Rn01_00037354 predicted 639
10 SASI_Rn01_00037357 predicted 2228
11 SASI_Rn01_00037348 predicted 1174
12 SASI_Rn01_00037349 predicted 1671
13 SASI_Rn01_00037350 predicted 1222
14 SASI_Rn01_00037352 predicted 2011
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009261 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00071313 predicted 1745
2 SASI_Mm01_00071314 predicted 1422
3 SASI_Mm01_00071316 predicted 1364
4 SASI_Mm01_00071317 predicted 991
5 SASI_Mm01_00071318 predicted 1869
6 SASI_Mm02_00315744 predicted 2200
7 SASI_Mm01_00071319 predicted 1128
8 SASI_Mm01_00071320 predicted 2004
9 SASI_Mm01_00071321 predicted 475
10 SASI_Mm02_00315745 predicted 283
11 SASI_Mm01_00071315 predicted 228
12 SASI_Mm01_00071322 predicted 1529
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018387
VALIDATED
STRBP MISSION shRNA Bacterial Glycerol Stock
spermatid perinuclear RNA binding protein
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000017718    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_018387.2-464s1c1
Sequence:CCGGCGCCATGTTATGGTGAAACATCTCGAGATGTTTCACCATAACATGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018387.2-1420s1c1
Sequence:CCGGCCTTCCATCTAGTAAGCCTTTCTCGAGAAAGGCTTACTAGATGGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017719    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_018387.2-2048s1c1
Sequence:CCGGCGCTTTGTAATGGAGGTAGAACTCGAGTTCTACCTCCATTACAAAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018387.2-1029s1c1
Sequence:CCGGCGTCTCTTCGACATGCCAAATCTCGAGATTTGGCATGTCGAAGAGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000017722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_018387.2-2378s1c1
Sequence:CCGGCCCAAGAGAATGGTTCTGTTACTCGAGTAACAGAACCATTCTCTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018387.4-978s21c1
Sequence:CCGGTGAAAGATCCTCCGGACTTATCTCGAGATAAGTCCGGAGGATCTTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018387.4-656s21c1
Sequence:CCGGGATCAAGGTGGTCGGACATTGCTCGAGCAATGTCCGACCACCTTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018387
VALIDATED
STRBP MISSION shRNA shRNA Plasmid DNA
spermatid perinuclear RNA binding protein
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000017718    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_018387.2-464s1c1
Sequence:CCGGCGCCATGTTATGGTGAAACATCTCGAGATGTTTCACCATAACATGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018387.2-1420s1c1
Sequence:CCGGCCTTCCATCTAGTAAGCCTTTCTCGAGAAAGGCTTACTAGATGGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017719    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_018387.2-2048s1c1
Sequence:CCGGCGCTTTGTAATGGAGGTAGAACTCGAGTTCTACCTCCATTACAAAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018387.2-1029s1c1
Sequence:CCGGCGTCTCTTCGACATGCCAAATCTCGAGATTTGGCATGTCGAAGAGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000017722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_018387.2-2378s1c1
Sequence:CCGGCCCAAGAGAATGGTTCTGTTACTCGAGTAACAGAACCATTCTCTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018387.4-978s21c1
Sequence:CCGGTGAAAGATCCTCCGGACTTATCTCGAGATAAGTCCGGAGGATCTTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018387.4-656s21c1
Sequence:CCGGGATCAAGGTGGTCGGACATTGCTCGAGCAATGTCCGACCACCTTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018387
VALIDATED
STRBP MISSION shRNA Lentiviral Transduction Particles
spermatid perinuclear RNA binding protein
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000017718    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_018387.2-464s1c1
Sequence:CCGGCGCCATGTTATGGTGAAACATCTCGAGATGTTTCACCATAACATGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018387.2-1420s1c1
Sequence:CCGGCCTTCCATCTAGTAAGCCTTTCTCGAGAAAGGCTTACTAGATGGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017719    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_018387.2-2048s1c1
Sequence:CCGGCGCTTTGTAATGGAGGTAGAACTCGAGTTCTACCTCCATTACAAAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018387.2-1029s1c1
Sequence:CCGGCGTCTCTTCGACATGCCAAATCTCGAGATTTGGCATGTCGAAGAGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000017722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_018387.2-2378s1c1
Sequence:CCGGCCCAAGAGAATGGTTCTGTTACTCGAGTAACAGAACCATTCTCTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018387.4-978s21c1
Sequence:CCGGTGAAAGATCCTCCGGACTTATCTCGAGATAAGTCCGGAGGATCTTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018387.4-656s21c1
Sequence:CCGGGATCAAGGTGGTCGGACATTGCTCGAGCAATGTCCGACCACCTTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009261
VALIDATED
STRBP MISSION shRNA Bacterial Glycerol Stock
spermatid perinuclear RNA binding protein
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000086391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009261.1-602s1c1
Sequence:CCGGCCCTCTAATTAGGGACGAATTCTCGAGAATTCGTCCCTAATTAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009261.1-1041s1c1
Sequence:CCGGGCACTTAGACTATCAGCCTTTCTCGAGAAAGGCTGATAGTCTAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009261.1-385s1c1
Sequence:CCGGGCTTGCTGATTAAAGATGATACTCGAGTATCATCTTTAATCAGCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009261.1-480s1c1
Sequence:CCGGCCTATTCAGATTCAGAAACTACTCGAGTAGTTTCTGAATCTGAATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086388    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009261.1-2138s1c1
Sequence:CCGGGCTGAGATATAGTGACTGTAACTCGAGTTACAGTCACTATATCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009261.3-448s21c1
Sequence:CCGGGCTTGCTGATTAAAGATGATACTCGAGTATCATCTTTAATCAGCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315988    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009261.3-5501s21c1
Sequence:CCGGGCTGAGATATAGTGACTGTAACTCGAGTTACAGTCACTATATCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315987    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009261.3-665s21c1
Sequence:CCGGCCCTCTAATTAGGGACGAATTCTCGAGAATTCGTCCCTAATTAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009261.3-543s21c1
Sequence:CCGGCCTATTCAGATTCAGAAACTACTCGAGTAGTTTCTGAATCTGAATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009261.3-1104s21c1
Sequence:CCGGGCACTTAGACTATCAGCCTTTCTCGAGAAAGGCTGATAGTCTAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009261
VALIDATED
STRBP MISSION shRNA shRNA Plasmid DNA
spermatid perinuclear RNA binding protein
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000086391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009261.1-602s1c1
Sequence:CCGGCCCTCTAATTAGGGACGAATTCTCGAGAATTCGTCCCTAATTAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009261.1-1041s1c1
Sequence:CCGGGCACTTAGACTATCAGCCTTTCTCGAGAAAGGCTGATAGTCTAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009261.1-385s1c1
Sequence:CCGGGCTTGCTGATTAAAGATGATACTCGAGTATCATCTTTAATCAGCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009261.1-480s1c1
Sequence:CCGGCCTATTCAGATTCAGAAACTACTCGAGTAGTTTCTGAATCTGAATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086388    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009261.1-2138s1c1
Sequence:CCGGGCTGAGATATAGTGACTGTAACTCGAGTTACAGTCACTATATCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009261.3-448s21c1
Sequence:CCGGGCTTGCTGATTAAAGATGATACTCGAGTATCATCTTTAATCAGCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315988    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009261.3-5501s21c1
Sequence:CCGGGCTGAGATATAGTGACTGTAACTCGAGTTACAGTCACTATATCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315987    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009261.3-665s21c1
Sequence:CCGGCCCTCTAATTAGGGACGAATTCTCGAGAATTCGTCCCTAATTAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009261.3-543s21c1
Sequence:CCGGCCTATTCAGATTCAGAAACTACTCGAGTAGTTTCTGAATCTGAATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009261.3-1104s21c1
Sequence:CCGGGCACTTAGACTATCAGCCTTTCTCGAGAAAGGCTGATAGTCTAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009261
VALIDATED
STRBP MISSION shRNA Lentiviral Transduction Particles
spermatid perinuclear RNA binding protein
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000086391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009261.1-602s1c1
Sequence:CCGGCCCTCTAATTAGGGACGAATTCTCGAGAATTCGTCCCTAATTAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009261.1-1041s1c1
Sequence:CCGGGCACTTAGACTATCAGCCTTTCTCGAGAAAGGCTGATAGTCTAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009261.1-385s1c1
Sequence:CCGGGCTTGCTGATTAAAGATGATACTCGAGTATCATCTTTAATCAGCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009261.1-480s1c1
Sequence:CCGGCCTATTCAGATTCAGAAACTACTCGAGTAGTTTCTGAATCTGAATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086388    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009261.1-2138s1c1
Sequence:CCGGGCTGAGATATAGTGACTGTAACTCGAGTTACAGTCACTATATCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315912    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009261.3-448s21c1
Sequence:CCGGGCTTGCTGATTAAAGATGATACTCGAGTATCATCTTTAATCAGCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315988    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009261.3-5501s21c1
Sequence:CCGGGCTGAGATATAGTGACTGTAACTCGAGTTACAGTCACTATATCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315987    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009261.3-665s21c1
Sequence:CCGGCCCTCTAATTAGGGACGAATTCTCGAGAATTCGTCCCTAATTAGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009261.3-543s21c1
Sequence:CCGGCCTATTCAGATTCAGAAACTACTCGAGTAGTTTCTGAATCTGAATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315985    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009261.3-1104s21c1
Sequence:CCGGGCACTTAGACTATCAGCCTTTCTCGAGAAAGGCTGATAGTCTAAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks