EMAIL THIS PAGE TO A FRIEND

STRC

stereocilin

Synonyms: DFNB16
UniProtKB ID: Q7RTU9
Gene ID:
Human(161497) Summary: This gene encodes a protein that is associated with the hair bundle of the sensory hair cells in the inner ear. The hair bundle is composed of stiff microvilli called stereocilia and is involved with mechanoreception of sound waves. This gene is part of a tandem duplication on chromosome 15; the second copy is a pseudogene. Mutations in this gene cause autosomal recessive non-syndromic deafness. [provided by RefSeq, Jul 2008]
Mouse(140476) stereocilin
Rat(691937) stereocilin
dog(478278) stereocilin
Horse(100056242) stereocilin
cow(528436) stereocilin
sheep(101108957) stereocilin
53 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA015731 Anti-STRC antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution mouse, human, rat
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153700 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153700 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153700 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_080459 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_080459 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_080459 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU104951 MISSION® esiRNA esiRNA human STRC (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153700 Rosetta Predictions human pricing
XM_001080205 Rosetta Predictions rat pricing
NM_080459 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153700 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00217729 predicted 5120
2 SASI_Hs01_00217732 predicted 5223
3 SASI_Hs01_00217733 predicted 4179
4 SASI_Hs02_00367414 predicted 4854
5 SASI_Hs01_00217734 predicted 2991
6 SASI_Hs01_00217735 predicted 3429
7 SASI_Hs01_00217736 predicted 3889
8 SASI_Hs02_00367415 predicted 4246
9 SASI_Hs01_00217738 predicted 930
10 SASI_Hs02_00367416 predicted 454
11 SASI_Hs01_00217730 predicted 5170
12 SASI_Hs01_00217731 predicted 5047
13 SASI_Hs01_00217737 predicted 3827
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001080205 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00367058 predicted 2047
2 SASI_Rn02_00367059 predicted 827
3 SASI_Rn02_00367060 predicted 5142
4 SASI_Rn02_00367061 predicted 3986
5 SASI_Rn02_00367062 predicted 4549
6 SASI_Rn02_00367063 predicted 3428
7 SASI_Rn02_00367064 predicted 5458
8 SASI_Rn02_00367065 predicted 4923
9 SASI_Rn02_00367066 predicted 5154
10 SASI_Rn02_00367067 predicted 3587
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080459 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00046587 predicted 4617
2 SASI_Mm01_00046588 predicted 3992
3 SASI_Mm01_00046590 predicted 4811
4 SASI_Mm01_00046592 predicted 3105
5 SASI_Mm01_00046593 predicted 4848
6 SASI_Mm02_00338124 predicted 840
7 SASI_Mm01_00046594 predicted 1990
8 SASI_Mm01_00046595 predicted 5243
9 SASI_Mm01_00046596 predicted 3951
10 SASI_Mm02_00338125 predicted 3435
11 SASI_Mm01_00046589 predicted 5148
12 SASI_Mm01_00046591 predicted 4556
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153700
STRC MISSION shRNA Bacterial Glycerol Stock
stereocilin
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000434232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153700.2-3891s21c1
Sequence:CCGGACTATCCAATGAATCCATTATCTCGAGATAATGGATTCATTGGATAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427004    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153700.2-4543s21c1
Sequence:CCGGGAGGACTGCCTGACATTATTTCTCGAGAAATAATGTCAGGCAGTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153700.2-5175s21c1
Sequence:CCGGGTTTAGTCCCATCCAACTATCCTCGAGGATAGTTGGATGGGACTAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153700.2-5011s21c1
Sequence:CCGGGGGTTTGGCCCAATCAGTAACCTCGAGGTTACTGATTGGGCCAAACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153700.2-3382s1c1
Sequence:CCGGCGGGTTAAAGATGGTGTTAAACTCGAGTTTAACACCATCTTTAACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153700.2-4459s1c1
Sequence:CCGGGTGCCAAATTGTGCAGATGTACTCGAGTACATCTGCACAATTTGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153700.2-3381s1c1
Sequence:CCGGTCGGGTTAAAGATGGTGTTAACTCGAGTTAACACCATCTTTAACCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153700.2-5123s1c1
Sequence:CCGGGCGTTACTCCTCTTGCCATTTCTCGAGAAATGGCAAGAGGAGTAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153700.2-4250s1c1
Sequence:CCGGGCCTAGTATTCACTCTGTCTACTCGAGTAGACAGAGTGAATACTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153700
STRC MISSION shRNA shRNA Plasmid DNA
stereocilin
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000434232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153700.2-3891s21c1
Sequence:CCGGACTATCCAATGAATCCATTATCTCGAGATAATGGATTCATTGGATAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427004    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153700.2-4543s21c1
Sequence:CCGGGAGGACTGCCTGACATTATTTCTCGAGAAATAATGTCAGGCAGTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153700.2-5175s21c1
Sequence:CCGGGTTTAGTCCCATCCAACTATCCTCGAGGATAGTTGGATGGGACTAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153700.2-5011s21c1
Sequence:CCGGGGGTTTGGCCCAATCAGTAACCTCGAGGTTACTGATTGGGCCAAACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153700.2-3382s1c1
Sequence:CCGGCGGGTTAAAGATGGTGTTAAACTCGAGTTTAACACCATCTTTAACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153700.2-4459s1c1
Sequence:CCGGGTGCCAAATTGTGCAGATGTACTCGAGTACATCTGCACAATTTGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153700.2-3381s1c1
Sequence:CCGGTCGGGTTAAAGATGGTGTTAACTCGAGTTAACACCATCTTTAACCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153700.2-5123s1c1
Sequence:CCGGGCGTTACTCCTCTTGCCATTTCTCGAGAAATGGCAAGAGGAGTAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153700.2-4250s1c1
Sequence:CCGGGCCTAGTATTCACTCTGTCTACTCGAGTAGACAGAGTGAATACTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153700
STRC MISSION shRNA Lentiviral Transduction Particles
stereocilin
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000434232    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153700.2-3891s21c1
Sequence:CCGGACTATCCAATGAATCCATTATCTCGAGATAATGGATTCATTGGATAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427004    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153700.2-4543s21c1
Sequence:CCGGGAGGACTGCCTGACATTATTTCTCGAGAAATAATGTCAGGCAGTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153700.2-5175s21c1
Sequence:CCGGGTTTAGTCCCATCCAACTATCCTCGAGGATAGTTGGATGGGACTAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153700.2-5011s21c1
Sequence:CCGGGGGTTTGGCCCAATCAGTAACCTCGAGGTTACTGATTGGGCCAAACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153700.2-3382s1c1
Sequence:CCGGCGGGTTAAAGATGGTGTTAAACTCGAGTTTAACACCATCTTTAACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153700.2-4459s1c1
Sequence:CCGGGTGCCAAATTGTGCAGATGTACTCGAGTACATCTGCACAATTTGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153700.2-3381s1c1
Sequence:CCGGTCGGGTTAAAGATGGTGTTAACTCGAGTTAACACCATCTTTAACCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153700.2-5123s1c1
Sequence:CCGGGCGTTACTCCTCTTGCCATTTCTCGAGAAATGGCAAGAGGAGTAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153700.2-4250s1c1
Sequence:CCGGGCCTAGTATTCACTCTGTCTACTCGAGTAGACAGAGTGAATACTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080459
STRC MISSION shRNA Bacterial Glycerol Stock
stereocilin
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000246875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080459.2-1468s21c1
Sequence:CCGGATCTGCGGCAACCTCTCATTTCTCGAGAAATGAGAGGTTGCCGCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246874    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080459.2-4365s21c1
Sequence:CCGGTCTGTCTGCTGAGGCTATTTCCTCGAGGAAATAGCCTCAGCAGACAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246873    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080459.2-4341s21c1
Sequence:CCGGGCAAGCTGGACGCCTAGTATTCTCGAGAATACTAGGCGTCCAGCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246872    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080459.2-5563s21c1
Sequence:CCGGATGGAAGTGCATACTAATTATCTCGAGATAATTAGTATGCACTTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080459.2-2914s21c1
Sequence:CCGGGTGCTTCGTAGCCTAGTAAACCTCGAGGTTTACTAGGCTACGAAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201804    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080459.1-1871s1c1
Sequence:CCGGGCAGAATTAGTCGTGGAGGAACTCGAGTTCCTCCACGACTAATTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191922    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080459.1-600s1c1
Sequence:CCGGGCCTTCTCTGATGTTGTTATTCTCGAGAATAACAACATCAGAGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080459
STRC MISSION shRNA shRNA Plasmid DNA
stereocilin
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000246875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080459.2-1468s21c1
Sequence:CCGGATCTGCGGCAACCTCTCATTTCTCGAGAAATGAGAGGTTGCCGCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246874    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080459.2-4365s21c1
Sequence:CCGGTCTGTCTGCTGAGGCTATTTCCTCGAGGAAATAGCCTCAGCAGACAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246873    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080459.2-4341s21c1
Sequence:CCGGGCAAGCTGGACGCCTAGTATTCTCGAGAATACTAGGCGTCCAGCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246872    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080459.2-5563s21c1
Sequence:CCGGATGGAAGTGCATACTAATTATCTCGAGATAATTAGTATGCACTTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080459.2-2914s21c1
Sequence:CCGGGTGCTTCGTAGCCTAGTAAACCTCGAGGTTTACTAGGCTACGAAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201804    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080459.1-1871s1c1
Sequence:CCGGGCAGAATTAGTCGTGGAGGAACTCGAGTTCCTCCACGACTAATTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191922    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080459.1-600s1c1
Sequence:CCGGGCCTTCTCTGATGTTGTTATTCTCGAGAATAACAACATCAGAGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080459
STRC MISSION shRNA Lentiviral Transduction Particles
stereocilin
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000246875    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080459.2-1468s21c1
Sequence:CCGGATCTGCGGCAACCTCTCATTTCTCGAGAAATGAGAGGTTGCCGCAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246874    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080459.2-4365s21c1
Sequence:CCGGTCTGTCTGCTGAGGCTATTTCCTCGAGGAAATAGCCTCAGCAGACAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246873    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080459.2-4341s21c1
Sequence:CCGGGCAAGCTGGACGCCTAGTATTCTCGAGAATACTAGGCGTCCAGCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246872    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_080459.2-5563s21c1
Sequence:CCGGATGGAAGTGCATACTAATTATCTCGAGATAATTAGTATGCACTTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246871    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080459.2-2914s21c1
Sequence:CCGGGTGCTTCGTAGCCTAGTAAACCTCGAGGTTTACTAGGCTACGAAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201804    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080459.1-1871s1c1
Sequence:CCGGGCAGAATTAGTCGTGGAGGAACTCGAGTTCCTCCACGACTAATTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191922    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_080459.1-600s1c1
Sequence:CCGGGCCTTCTCTGATGTTGTTATTCTCGAGAATAACAACATCAGAGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks