EMAIL THIS PAGE TO A FRIEND

STRIP1

striatin interacting protein 1

Synonyms: FAM40A FAR11A
Gene ID:
Human(85369) Summary: This gene encodes a member of the striatin-interacting phosphatase and kinase complex, which is involved in localization of the Golgi body. The encoded protein participates in cytosketelal organization. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2012]
Mouse(229707) striatin interacting protein 1
Rat(362012) striatin interacting protein 1
cow(511120) family with sequence similarity 40, member A
sheep(101104453) striatin interacting protein 1
Zebrafish(568805) striatin interacting protein 1
146 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153563 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153563 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153563 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_033088 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033088 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033088 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU046271 MISSION® esiRNA esiRNA human FAM40A (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033088 Rosetta Predictions human pricing
XM_001068196 Rosetta Predictions rat pricing
XM_001068248 Rosetta Predictions rat pricing
XM_001068288 Rosetta Predictions rat pricing
XM_001075052 Rosetta Predictions rat pricing
XM_342311 Rosetta Predictions rat pricing
NM_153563 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033088 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00044200 predicted 2014
2 SASI_Hs01_00044201 predicted 1338
3 SASI_Hs02_00360792 predicted 1900
4 SASI_Hs01_00044202 predicted 2380
5 SASI_Hs01_00044203 predicted 685
6 SASI_Hs01_00044204 predicted 2339
7 SASI_Hs02_00360793 predicted 2102
8 SASI_Hs01_00044206 predicted 1777
9 SASI_Hs01_00044207 predicted 668
10 SASI_Hs02_00360794 predicted 1432
11 SASI_Hs01_00044205 predicted 1729
12 SASI_Hs01_00044208 predicted 1730
13 SASI_Hs01_00044209 predicted 1849
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001068196 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00323795 predicted 2268
2 SASI_Rn02_00323796 predicted 1026
3 SASI_Rn02_00323797 predicted 1968
4 SASI_Rn02_00323798 predicted 225
5 SASI_Rn02_00323799 predicted 1340
6 SASI_Rn02_00323800 predicted 2310
7 SASI_Rn02_00323801 predicted 1037
8 SASI_Rn02_00323802 predicted 2377
9 SASI_Rn02_00323803 predicted 477
10 SASI_Rn02_00323804 predicted 1396
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001068248 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00323947 predicted 2380
2 SASI_Rn02_00323948 predicted 1110
3 SASI_Rn02_00323949 predicted 2076
4 SASI_Rn02_00323950 predicted 235
5 SASI_Rn02_00323951 predicted 301
6 SASI_Rn02_00323952 predicted 1435
7 SASI_Rn02_00323953 predicted 2415
8 SASI_Rn02_00323954 predicted 1124
9 SASI_Rn02_00323955 predicted 564
10 SASI_Rn02_00323956 predicted 1486
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001068288 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00324091 predicted 2355
2 SASI_Rn02_00324092 predicted 1113
3 SASI_Rn02_00324093 predicted 2060
4 SASI_Rn02_00324094 predicted 233
5 SASI_Rn02_00324095 predicted 302
6 SASI_Rn02_00324096 predicted 1433
7 SASI_Rn02_00324097 predicted 2396
8 SASI_Rn02_00324098 predicted 1122
9 SASI_Rn02_00324099 predicted 569
10 SASI_Rn02_00324100 predicted 1488
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001075052 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00348251 predicted 2273
2 SASI_Rn02_00348252 predicted 1024
3 SASI_Rn02_00348253 predicted 1969
4 SASI_Rn02_00348254 predicted 225
5 SASI_Rn02_00348255 predicted 1344
6 SASI_Rn02_00348256 predicted 2306
7 SASI_Rn02_00348257 predicted 1036
8 SASI_Rn02_00348258 predicted 2375
9 SASI_Rn02_00348259 predicted 481
10 SASI_Rn02_00348260 predicted 1400
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_342311 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00394097 predicted 2446
2 SASI_Rn02_00394098 predicted 1209
3 SASI_Rn02_00394099 predicted 2152
4 SASI_Rn02_00394100 predicted 326
5 SASI_Rn02_00394101 predicted 393
6 SASI_Rn02_00394102 predicted 1524
7 SASI_Rn02_00394103 predicted 291
8 SASI_Rn02_00394104 predicted 2492
9 SASI_Rn02_00394105 predicted 1218
10 SASI_Rn02_00394106 predicted 658
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153563 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00343356 predicted 2353
2 SASI_Mm01_00120545 predicted 1582
3 SASI_Mm01_00120546 predicted 810
4 SASI_Mm01_00120547 predicted 2415
5 SASI_Mm02_00343357 predicted 227
6 SASI_Mm02_00343358 predicted 297
7 SASI_Mm01_00120549 predicted 2056
8 SASI_Mm01_00120550 predicted 2427
9 SASI_Mm01_00120551 predicted 567
10 SASI_Mm01_00120552 predicted 1488
11 SASI_Mm01_00120548 predicted 1646
12 SASI_Mm01_00120553 predicted 576
13 SASI_Mm01_00120554 predicted 1117
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153563
STRIP1 MISSION shRNA Bacterial Glycerol Stock
striatin interacting protein 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000198932    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153563.1-1712s1c1
Sequence:CCGGGCCACAAAGAGGTCATCGTTACTCGAGTAACGATGACCTCTTTGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198240    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153563.1-1075s1c1
Sequence:CCGGGCTCTGATAAAGCAGGACAATCTCGAGATTGTCCTGCTTTATCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181709    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153563.1-870s1c1
Sequence:CCGGGCTGCTCTGGAAGACTGTATTCTCGAGAATACAGTCTTCCAGAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217174    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153563.2-811s1c1
Sequence:CCGGCCATTTGCCATCATGCTATTTCTCGAGAAATAGCATGATGGCAAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153563.2-530s21c1
Sequence:CCGGTCTGGATGCGCTACAACATATCTCGAGATATGTTGTAGCGCATCCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153563.2-811s21c1
Sequence:CCGGCCATTTGCCATCATGCTATTTCTCGAGAAATAGCATGATGGCAAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265033    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153563.2-2689s21c1
Sequence:CCGGAGGTTAGCCTCTGGTTGATTCCTCGAGGAATCAACCAGAGGCTAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265031    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153563.2-1828s21c1
Sequence:CCGGATGGCCCAGCACCTGGTATTTCTCGAGAAATACCAGGTGCTGGGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000283265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153563.2-1131s21c1
Sequence:CCGGCAACGAGCGGGATCCCTATAACTCGAGTTATAGGGATCCCGCTCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153563
STRIP1 MISSION shRNA shRNA Plasmid DNA
striatin interacting protein 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000198932    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153563.1-1712s1c1
Sequence:CCGGGCCACAAAGAGGTCATCGTTACTCGAGTAACGATGACCTCTTTGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198240    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153563.1-1075s1c1
Sequence:CCGGGCTCTGATAAAGCAGGACAATCTCGAGATTGTCCTGCTTTATCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181709    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153563.1-870s1c1
Sequence:CCGGGCTGCTCTGGAAGACTGTATTCTCGAGAATACAGTCTTCCAGAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217174    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153563.2-811s1c1
Sequence:CCGGCCATTTGCCATCATGCTATTTCTCGAGAAATAGCATGATGGCAAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153563.2-530s21c1
Sequence:CCGGTCTGGATGCGCTACAACATATCTCGAGATATGTTGTAGCGCATCCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153563.2-811s21c1
Sequence:CCGGCCATTTGCCATCATGCTATTTCTCGAGAAATAGCATGATGGCAAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265033    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153563.2-2689s21c1
Sequence:CCGGAGGTTAGCCTCTGGTTGATTCCTCGAGGAATCAACCAGAGGCTAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265031    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153563.2-1828s21c1
Sequence:CCGGATGGCCCAGCACCTGGTATTTCTCGAGAAATACCAGGTGCTGGGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000283265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153563.2-1131s21c1
Sequence:CCGGCAACGAGCGGGATCCCTATAACTCGAGTTATAGGGATCCCGCTCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153563
STRIP1 MISSION shRNA Lentiviral Transduction Particles
striatin interacting protein 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000198932    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153563.1-1712s1c1
Sequence:CCGGGCCACAAAGAGGTCATCGTTACTCGAGTAACGATGACCTCTTTGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198240    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153563.1-1075s1c1
Sequence:CCGGGCTCTGATAAAGCAGGACAATCTCGAGATTGTCCTGCTTTATCAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181709    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153563.1-870s1c1
Sequence:CCGGGCTGCTCTGGAAGACTGTATTCTCGAGAATACAGTCTTCCAGAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217174    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153563.2-811s1c1
Sequence:CCGGCCATTTGCCATCATGCTATTTCTCGAGAAATAGCATGATGGCAAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265030    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153563.2-530s21c1
Sequence:CCGGTCTGGATGCGCTACAACATATCTCGAGATATGTTGTAGCGCATCCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265032    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153563.2-811s21c1
Sequence:CCGGCCATTTGCCATCATGCTATTTCTCGAGAAATAGCATGATGGCAAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265033    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153563.2-2689s21c1
Sequence:CCGGAGGTTAGCCTCTGGTTGATTCCTCGAGGAATCAACCAGAGGCTAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265031    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153563.2-1828s21c1
Sequence:CCGGATGGCCCAGCACCTGGTATTTCTCGAGAAATACCAGGTGCTGGGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000283265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153563.2-1131s21c1
Sequence:CCGGCAACGAGCGGGATCCCTATAACTCGAGTTATAGGGATCCCGCTCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033088
VALIDATED
STRIP1 MISSION shRNA Bacterial Glycerol Stock
striatin interacting protein 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166740    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033088.1-1687s1c1
Sequence:CCGGCCCACTTGAACTCTGCATGAACTCGAGTTCATGCAGAGTTCAAGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160888    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_033088.1-1561s1c1
Sequence:CCGGGCTCAAGCACTTTAAGTTGAACTCGAGTTCAACTTAAAGTGCTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164556    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033088.1-1803s1c1
Sequence:CCGGCCTGTTGGCTTCAGTTTGAATCTCGAGATTCAAACTGAAGCCAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_033088.1-818s1c1
Sequence:CCGGGCATCTGCTTCAGACTTGATTCTCGAGAATCAAGTCTGAAGCAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163501    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033088.1-1520s1c1
Sequence:CCGGGAGGTCATTGTTAAGGCCATTCTCGAGAATGGCCTTAACAATGACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164502    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033088.1-1198s1c1
Sequence:CCGGCGAAAGCATCAAGACTCTGAACTCGAGTTCAGAGTCTTGATGCTTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033088.2-1979s21c1
Sequence:CCGGGCAGGTGACAGTAACCAATTTCTCGAGAAATTGGTTACTGTCACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418995    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033088.2-2958s21c1
Sequence:CCGGGGGCCAGAAAGTCGGTATCTTCTCGAGAAGATACCGACTTTCTGGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033088.2-468s21c1
Sequence:CCGGATGTTGCTCAAGGCACGTTTGCTCGAGCAAACGTGCCTTGAGCAACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033088.2-522s21c1
Sequence:CCGGGGATGCGCTACAACATCTTTCCTCGAGGAAAGATGTTGTAGCGCATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033088
VALIDATED
STRIP1 MISSION shRNA shRNA Plasmid DNA
striatin interacting protein 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166740    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033088.1-1687s1c1
Sequence:CCGGCCCACTTGAACTCTGCATGAACTCGAGTTCATGCAGAGTTCAAGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160888    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_033088.1-1561s1c1
Sequence:CCGGGCTCAAGCACTTTAAGTTGAACTCGAGTTCAACTTAAAGTGCTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164556    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033088.1-1803s1c1
Sequence:CCGGCCTGTTGGCTTCAGTTTGAATCTCGAGATTCAAACTGAAGCCAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_033088.1-818s1c1
Sequence:CCGGGCATCTGCTTCAGACTTGATTCTCGAGAATCAAGTCTGAAGCAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163501    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033088.1-1520s1c1
Sequence:CCGGGAGGTCATTGTTAAGGCCATTCTCGAGAATGGCCTTAACAATGACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164502    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033088.1-1198s1c1
Sequence:CCGGCGAAAGCATCAAGACTCTGAACTCGAGTTCAGAGTCTTGATGCTTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033088.2-1979s21c1
Sequence:CCGGGCAGGTGACAGTAACCAATTTCTCGAGAAATTGGTTACTGTCACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418995    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033088.2-2958s21c1
Sequence:CCGGGGGCCAGAAAGTCGGTATCTTCTCGAGAAGATACCGACTTTCTGGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033088.2-468s21c1
Sequence:CCGGATGTTGCTCAAGGCACGTTTGCTCGAGCAAACGTGCCTTGAGCAACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033088.2-522s21c1
Sequence:CCGGGGATGCGCTACAACATCTTTCCTCGAGGAAAGATGTTGTAGCGCATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033088
VALIDATED
STRIP1 MISSION shRNA Lentiviral Transduction Particles
striatin interacting protein 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166740    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033088.1-1687s1c1
Sequence:CCGGCCCACTTGAACTCTGCATGAACTCGAGTTCATGCAGAGTTCAAGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160888    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_033088.1-1561s1c1
Sequence:CCGGGCTCAAGCACTTTAAGTTGAACTCGAGTTCAACTTAAAGTGCTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164556    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033088.1-1803s1c1
Sequence:CCGGCCTGTTGGCTTCAGTTTGAATCTCGAGATTCAAACTGAAGCCAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_033088.1-818s1c1
Sequence:CCGGGCATCTGCTTCAGACTTGATTCTCGAGAATCAAGTCTGAAGCAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163501    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033088.1-1520s1c1
Sequence:CCGGGAGGTCATTGTTAAGGCCATTCTCGAGAATGGCCTTAACAATGACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164502    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033088.1-1198s1c1
Sequence:CCGGCGAAAGCATCAAGACTCTGAACTCGAGTTCAGAGTCTTGATGCTTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436153    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033088.2-1979s21c1
Sequence:CCGGGCAGGTGACAGTAACCAATTTCTCGAGAAATTGGTTACTGTCACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418995    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033088.2-2958s21c1
Sequence:CCGGGGGCCAGAAAGTCGGTATCTTCTCGAGAAGATACCGACTTTCTGGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033088.2-468s21c1
Sequence:CCGGATGTTGCTCAAGGCACGTTTGCTCGAGCAAACGTGCCTTGAGCAACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433056    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033088.2-522s21c1
Sequence:CCGGGGATGCGCTACAACATCTTTCCTCGAGGAAAGATGTTGTAGCGCATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks