EMAIL THIS PAGE TO A FRIEND

STRIP2

striatin interacting protein 2

Synonyms: FAM40B FAR11B
UniProtKB ID: Q9ULQ0, Q8WUZ4
Gene ID:
Mouse(320609) striatin interacting protein 2
dog(482261) striatin interacting protein 2
domestic guinea pig(100732869) striatin interacting protein 2
naked mole-rat(101706904) striatin interacting protein 2
cow(529423) striatin interacting protein 2
sheep(101105908) striatin interacting protein 2
124 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020704 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020704 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020704 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177204 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177204 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177204 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_379923 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_379923 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_379923 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020704 Rosetta Predictions human pricing
NM_001037740 Rosetta Predictions mouse pricing
NM_177204 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020704 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00056309 predicted 2300
2 SASI_Hs01_00056310 predicted 1399
3 SASI_Hs02_00353710 predicted 1392
4 SASI_Hs01_00056311 predicted 1679
5 SASI_Hs01_00056312 predicted 1607
6 SASI_Hs01_00056313 predicted 1728
7 SASI_Hs01_00056314 predicted 2586
8 SASI_Hs01_00056315 predicted 2143
9 SASI_Hs01_00056316 predicted 2138
10 SASI_Hs01_00056318 predicted 1535
11 SASI_Hs01_00056317 predicted 929
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037740 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00169221 predicted 999
2 SASI_Mm02_00289388 predicted 2410
3 SASI_Mm01_00169222 predicted 1739
4 SASI_Mm01_00169223 predicted 275
5 SASI_Mm01_00169224 predicted 1835
6 SASI_Mm01_00169225 predicted 529
7 SASI_Mm01_00169226 predicted 2544
8 SASI_Mm01_00169227 predicted 484
9 SASI_Mm01_00169228 predicted 1502
10 SASI_Mm01_00169229 predicted 313
11 SASI_Mm01_00169230 predicted 658
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177204 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00183570 predicted 999
2 SASI_Mm02_00347222 predicted 2491
3 SASI_Mm01_00183571 predicted 1738
4 SASI_Mm01_00183572 predicted 274
5 SASI_Mm01_00183573 predicted 1837
6 SASI_Mm01_00183574 predicted 534
7 SASI_Mm01_00183575 predicted 2623
8 SASI_Mm01_00183576 predicted 481
9 SASI_Mm01_00183577 predicted 1501
10 SASI_Mm01_00183578 predicted 315
11 SASI_Mm01_00183579 predicted 648
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020704
VALIDATED
STRIP2 MISSION shRNA Bacterial Glycerol Stock
striatin interacting protein 2
Human
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000446483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020704.2-1569s21c1
Sequence:CCGGTGTACAGCCTTCCGCAGTATACTCGAGTATACTGCGGAAGGCTGTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412588    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020704.2-2683s21c1
Sequence:CCGGGGGATCCTGAATCACAATAAACTCGAGTTTATTGTGATTCAGGATCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020704.2-744s21c1
Sequence:CCGGTAAGCTTCTCCATGCATAATGCTCGAGCATTATGCATGGAGAAGCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020704.2-1434s21c1
Sequence:CCGCCCCTAAAGCAGCACAAGTATACTCGAGTATACTTGTGCTGCTTTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020704.2-2103s21c1
Sequence:CCGGTTAAATCGGCACCAATCTTAACTCGAGTTAAGATTGGTGCCGATTTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143653    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_020704.1-165s1c1
Sequence:CCGGCTGGAGTTTGAGTATGGAGATCTCGAGATCTCCATACTCAAACTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141806    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020704.1-309s1c1
Sequence:CCGGGAGTTGGAAGAAGATGCCCAACTCGAGTTGGGCATCTTCTTCCAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142014    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020704.1-2385s1c1
Sequence:CCGGGATAACTGCTTGCAGAGCGTACTCGAGTACGCTCTGCAAGCAGTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142736    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020704.1-2294s1c1
Sequence:CCGGCCAAGCAGAAGAATGTACCTTCTCGAGAAGGTACATTCTTCTGCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142787    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020704.1-3483s1c1
Sequence:CCGGCCCGTTTATTGCTAGCAGTTTCTCGAGAAACTGCTAGCAATAAACGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143377    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020704.1-435s1c1
Sequence:CCGGGAATGTGATTCAGAGGTCGATCTCGAGATCGACCTCTGAATCACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145390    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_020704.1-620s1c1
Sequence:CCGGGCTGAGTGTTATGTACCTAATCTCGAGATTAGGTACATAACACTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145355    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_020704.1-3613s1c1
Sequence:CCGGGCAGAATCACATACTTCTCAACTCGAGTTGAGAAGTATGTGATTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_020704.1-2126s1c1
Sequence:CCGGGCTGCAACTTTATGTCCTAAACTCGAGTTTAGGACATAAAGTTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144412    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020704.1-1085s1c1
Sequence:CCGGCTACAATGAAAGGGATCTCTTCTCGAGAAGAGATCCCTTTCATTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020704.1-1611s1c1
Sequence:CCGGGCTAAGACAGACTCTATCAATCTCGAGATTGATAGAGTCTGTCTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020704
VALIDATED
STRIP2 MISSION shRNA shRNA Plasmid DNA
striatin interacting protein 2
Human
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000446483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020704.2-1569s21c1
Sequence:CCGGTGTACAGCCTTCCGCAGTATACTCGAGTATACTGCGGAAGGCTGTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412588    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020704.2-2683s21c1
Sequence:CCGGGGGATCCTGAATCACAATAAACTCGAGTTTATTGTGATTCAGGATCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020704.2-744s21c1
Sequence:CCGGTAAGCTTCTCCATGCATAATGCTCGAGCATTATGCATGGAGAAGCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020704.2-1434s21c1
Sequence:CCGCCCCTAAAGCAGCACAAGTATACTCGAGTATACTTGTGCTGCTTTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020704.2-2103s21c1
Sequence:CCGGTTAAATCGGCACCAATCTTAACTCGAGTTAAGATTGGTGCCGATTTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143653    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_020704.1-165s1c1
Sequence:CCGGCTGGAGTTTGAGTATGGAGATCTCGAGATCTCCATACTCAAACTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141806    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020704.1-309s1c1
Sequence:CCGGGAGTTGGAAGAAGATGCCCAACTCGAGTTGGGCATCTTCTTCCAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142014    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020704.1-2385s1c1
Sequence:CCGGGATAACTGCTTGCAGAGCGTACTCGAGTACGCTCTGCAAGCAGTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142736    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020704.1-2294s1c1
Sequence:CCGGCCAAGCAGAAGAATGTACCTTCTCGAGAAGGTACATTCTTCTGCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142787    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020704.1-3483s1c1
Sequence:CCGGCCCGTTTATTGCTAGCAGTTTCTCGAGAAACTGCTAGCAATAAACGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143377    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020704.1-435s1c1
Sequence:CCGGGAATGTGATTCAGAGGTCGATCTCGAGATCGACCTCTGAATCACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145390    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_020704.1-620s1c1
Sequence:CCGGGCTGAGTGTTATGTACCTAATCTCGAGATTAGGTACATAACACTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145355    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_020704.1-3613s1c1
Sequence:CCGGGCAGAATCACATACTTCTCAACTCGAGTTGAGAAGTATGTGATTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_020704.1-2126s1c1
Sequence:CCGGGCTGCAACTTTATGTCCTAAACTCGAGTTTAGGACATAAAGTTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144412    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020704.1-1085s1c1
Sequence:CCGGCTACAATGAAAGGGATCTCTTCTCGAGAAGAGATCCCTTTCATTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020704.1-1611s1c1
Sequence:CCGGGCTAAGACAGACTCTATCAATCTCGAGATTGATAGAGTCTGTCTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020704
VALIDATED
STRIP2 MISSION shRNA Lentiviral Transduction Particles
striatin interacting protein 2
Human
16 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000446483    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020704.2-1569s21c1
Sequence:CCGGTGTACAGCCTTCCGCAGTATACTCGAGTATACTGCGGAAGGCTGTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412588    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020704.2-2683s21c1
Sequence:CCGGGGGATCCTGAATCACAATAAACTCGAGTTTATTGTGATTCAGGATCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020704.2-744s21c1
Sequence:CCGGTAAGCTTCTCCATGCATAATGCTCGAGCATTATGCATGGAGAAGCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416097    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020704.2-1434s21c1
Sequence:CCGCCCCTAAAGCAGCACAAGTATACTCGAGTATACTTGTGCTGCTTTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432779    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020704.2-2103s21c1
Sequence:CCGGTTAAATCGGCACCAATCTTAACTCGAGTTAAGATTGGTGCCGATTTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143653    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_020704.1-165s1c1
Sequence:CCGGCTGGAGTTTGAGTATGGAGATCTCGAGATCTCCATACTCAAACTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141806    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020704.1-309s1c1
Sequence:CCGGGAGTTGGAAGAAGATGCCCAACTCGAGTTGGGCATCTTCTTCCAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142014    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020704.1-2385s1c1
Sequence:CCGGGATAACTGCTTGCAGAGCGTACTCGAGTACGCTCTGCAAGCAGTTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142736    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020704.1-2294s1c1
Sequence:CCGGCCAAGCAGAAGAATGTACCTTCTCGAGAAGGTACATTCTTCTGCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142787    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_020704.1-3483s1c1
Sequence:CCGGCCCGTTTATTGCTAGCAGTTTCTCGAGAAACTGCTAGCAATAAACGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143377    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020704.1-435s1c1
Sequence:CCGGGAATGTGATTCAGAGGTCGATCTCGAGATCGACCTCTGAATCACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145390    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_020704.1-620s1c1
Sequence:CCGGGCTGAGTGTTATGTACCTAATCTCGAGATTAGGTACATAACACTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145355    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_020704.1-3613s1c1
Sequence:CCGGGCAGAATCACATACTTCTCAACTCGAGTTGAGAAGTATGTGATTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144802    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_020704.1-2126s1c1
Sequence:CCGGGCTGCAACTTTATGTCCTAAACTCGAGTTTAGGACATAAAGTTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144412    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020704.1-1085s1c1
Sequence:CCGGCTACAATGAAAGGGATCTCTTCTCGAGAAGAGATCCCTTTCATTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020704.1-1611s1c1
Sequence:CCGGGCTAAGACAGACTCTATCAATCTCGAGATTGATAGAGTCTGTCTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177204
STRIP2 MISSION shRNA Bacterial Glycerol Stock
striatin interacting protein 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000215324    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177204.3-1690s1c1
Sequence:CCGGCTAAGACAGACTCTATCAATACTCGAGTATTGATAGAGTCTGTCTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215819    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177204.3-1511s1c1
Sequence:CCGGCATTGCAGATATACAGATAAACTCGAGTTTATCTGTATATCTGCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264787    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177204.3-4361s21c1
Sequence:CCGGTGTACTGGAAGTATCATATATCTCGAGATATATGATACTTCCAGTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177204.3-449s21c1
Sequence:CCGGCAGTAGGGAGAAACGGCTTAACTCGAGTTAAGCCGTTTCTCCCTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264785    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177204.3-1487s21c1
Sequence:CCGGTCTAAAGCAGCACAAGTATATCTCGAGATATACTTGTGCTGCTTTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000264784    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177204.3-1690s21c1
Sequence:CCGGCTAAGACAGACTCTATCAATACTCGAGTATTGATAGAGTCTGTCTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000283172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177204.3-699s21c1
Sequence:CCGGCTGAGTGTCATGTACCTAATGCTCGAGCATTAGGTACATGACACTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192120    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177204.2-807s1c1
Sequence:CCGGCACACATAATGAAGAGCCGTTCTCGAGAACGGCTCTTCATTATGTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191890    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177204.2-3616s1c1
Sequence:CCGGGCACATTGAATGCTTCATCATCTCGAGATGATGAAGCATTCAATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177204
STRIP2 MISSION shRNA shRNA Plasmid DNA
striatin interacting protein 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000215324    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177204.3-1690s1c1
Sequence:CCGGCTAAGACAGACTCTATCAATACTCGAGTATTGATAGAGTCTGTCTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215819    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177204.3-1511s1c1
Sequence:CCGGCATTGCAGATATACAGATAAACTCGAGTTTATCTGTATATCTGCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264787    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177204.3-4361s21c1
Sequence:CCGGTGTACTGGAAGTATCATATATCTCGAGATATATGATACTTCCAGTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177204.3-449s21c1
Sequence:CCGGCAGTAGGGAGAAACGGCTTAACTCGAGTTAAGCCGTTTCTCCCTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264785    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177204.3-1487s21c1
Sequence:CCGGTCTAAAGCAGCACAAGTATATCTCGAGATATACTTGTGCTGCTTTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000264784    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177204.3-1690s21c1
Sequence:CCGGCTAAGACAGACTCTATCAATACTCGAGTATTGATAGAGTCTGTCTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000283172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177204.3-699s21c1
Sequence:CCGGCTGAGTGTCATGTACCTAATGCTCGAGCATTAGGTACATGACACTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192120    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177204.2-807s1c1
Sequence:CCGGCACACATAATGAAGAGCCGTTCTCGAGAACGGCTCTTCATTATGTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191890    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177204.2-3616s1c1
Sequence:CCGGGCACATTGAATGCTTCATCATCTCGAGATGATGAAGCATTCAATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177204
STRIP2 MISSION shRNA Lentiviral Transduction Particles
striatin interacting protein 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000215324    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177204.3-1690s1c1
Sequence:CCGGCTAAGACAGACTCTATCAATACTCGAGTATTGATAGAGTCTGTCTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215819    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177204.3-1511s1c1
Sequence:CCGGCATTGCAGATATACAGATAAACTCGAGTTTATCTGTATATCTGCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264787    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177204.3-4361s21c1
Sequence:CCGGTGTACTGGAAGTATCATATATCTCGAGATATATGATACTTCCAGTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264786    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177204.3-449s21c1
Sequence:CCGGCAGTAGGGAGAAACGGCTTAACTCGAGTTAAGCCGTTTCTCCCTACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264785    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177204.3-1487s21c1
Sequence:CCGGTCTAAAGCAGCACAAGTATATCTCGAGATATACTTGTGCTGCTTTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000264784    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177204.3-1690s21c1
Sequence:CCGGCTAAGACAGACTCTATCAATACTCGAGTATTGATAGAGTCTGTCTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000283172    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177204.3-699s21c1
Sequence:CCGGCTGAGTGTCATGTACCTAATGCTCGAGCATTAGGTACATGACACTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192120    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177204.2-807s1c1
Sequence:CCGGCACACATAATGAAGAGCCGTTCTCGAGAACGGCTCTTCATTATGTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191890    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177204.2-3616s1c1
Sequence:CCGGGCACATTGAATGCTTCATCATCTCGAGATGATGAAGCATTCAATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_379923
STRIP2 MISSION shRNA Bacterial Glycerol Stock
striatin interacting protein 2
Human
2 Products Total
TRC Number Price Set Price (2)? Select
TRCN0000122269    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_379923.1-365s1c1
Sequence:CCGGCCGAGTTGTCAGAATTGTATACTCGAGTATACAATTCTGACAACTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121875    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_379923.1-1243s1c1
Sequence:CCGGGACATCTACAATGAAAGGGATCTCGAGATCCCTTTCATTGTAGATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_379923
STRIP2 MISSION shRNA shRNA Plasmid DNA
striatin interacting protein 2
Human
2 Products Total
TRC Number Vector Price Set Price (2)? Select
TRCN0000122269    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_379923.1-365s1c1
Sequence:CCGGCCGAGTTGTCAGAATTGTATACTCGAGTATACAATTCTGACAACTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121875    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_379923.1-1243s1c1
Sequence:CCGGGACATCTACAATGAAAGGGATCTCGAGATCCCTTTCATTGTAGATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_379923
STRIP2 MISSION shRNA Lentiviral Transduction Particles
striatin interacting protein 2
Human
2 Products Total
TRC Number Volume Titer Vector Price Set Price (2)? Select
TRCN0000122269    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_379923.1-365s1c1
Sequence:CCGGCCGAGTTGTCAGAATTGTATACTCGAGTATACAATTCTGACAACTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121875    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_379923.1-1243s1c1
Sequence:CCGGGACATCTACAATGAAAGGGATCTCGAGATCCCTTTCATTGTAGATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks