EMAIL THIS PAGE TO A FRIEND

STRN3

striatin, calmodulin binding protein 3

Synonyms: SG2NA
UniProtKB ID: Q13033, A2RTX7, A6NHZ7, Q9NRA5
Gene ID:
Mouse(94186) striatin, calmodulin binding protein 3
Rat(114520) striatin, calmodulin binding protein 3
Zebrafish(563124) striatin, calmodulin binding protein 3
domestic cat(101081307) striatin, calmodulin binding protein 3
Horse(100050070) striatin, calmodulin binding protein 3
dog(480282) striatin, calmodulin binding protein 3
chicken(423308) striatin, calmodulin binding protein 3
domestic guinea pig(100732810) striatin, calmodulin binding protein 3
naked mole-rat(101701337) striatin, calmodulin binding protein 3
cow(516375) striatin, calmodulin binding protein 3
sheep(101102517) striatin, calmodulin binding protein 3
149 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014574 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014574 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014574 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_052973 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_052973 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_052973 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001083893 Rosetta Predictions human pricing
NM_014574 Rosetta Predictions human pricing
NM_001029897 Rosetta Predictions rat pricing
NM_052973 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001083893 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00317211 predicted 881
2 SASI_Hs02_00317212 predicted 2679
3 SASI_Hs02_00317213 predicted 776
4 SASI_Hs02_00317214 predicted 2254
5 SASI_Hs02_00317215 predicted 2477
6 SASI_Hs02_00317216 predicted 2377
7 SASI_Hs02_00317217 predicted 2684
8 SASI_Hs02_00317218 predicted 2664
9 SASI_Hs02_00317219 predicted 2112
10 SASI_Hs02_00317220 predicted 2154
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014574 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00070223 predicted 881
2 SASI_Hs02_00345847 predicted 2426
3 SASI_Hs01_00070224 predicted 777
4 SASI_Hs01_00070225 predicted 2004
5 SASI_Hs01_00070226 predicted 2220
6 SASI_Hs01_00070227 predicted 2124
7 SASI_Hs01_00070228 predicted 2434
8 SASI_Hs02_00345848 predicted 2411
9 SASI_Hs01_00070230 predicted 1857
10 SASI_Hs01_00070232 predicted 1902
11 SASI_Hs01_00070229 predicted 2040
12 SASI_Hs01_00070231 predicted 1364
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001029897 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00067234 predicted 2007
2 SASI_Rn01_00067236 predicted 539
3 SASI_Rn01_00067237 predicted 1082
4 SASI_Rn02_00203456 predicted 742
5 SASI_Rn01_00067238 predicted 752
6 SASI_Rn01_00067240 predicted 2491
7 SASI_Rn02_00203457 predicted 1313
8 SASI_Rn01_00067241 predicted 2134
9 SASI_Rn01_00067242 predicted 1862
10 SASI_Rn02_00203458 predicted 2434
11 SASI_Rn01_00067235 predicted 1544
12 SASI_Rn01_00067239 predicted 387
13 SASI_Rn01_00067243 predicted 725
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_052973 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00116487 predicted 542
2 SASI_Mm01_00116488 predicted 1088
3 SASI_Mm01_00116489 predicted 2232
4 SASI_Mm01_00116491 predicted 2340
5 SASI_Mm01_00116492 predicted 819
6 SASI_Mm01_00116493 predicted 1754
7 SASI_Mm01_00116494 predicted 723
8 SASI_Mm01_00116495 predicted 1979
9 SASI_Mm02_00337495 predicted 1314
10 SASI_Mm01_00116496 predicted 1866
11 SASI_Mm01_00116490 predicted 2016
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014574
VALIDATED
STRN3 MISSION shRNA Bacterial Glycerol Stock
striatin, calmodulin binding protein 3
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000377467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014574.3-944s21c1
Sequence:CCGGATGTTCTTGAGACGTTCAATTCTCGAGAATTGAACGTCTCAAGAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365147    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_014574.3-2157s21c1
Sequence:CCGGAGATCCTAATGGAATCTATTTCTCGAGAAATAGATTCCATTAGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_014574.3-1987s21c1
Sequence:CCGGGATTCTGGTTTACAATCTAATCTCGAGATTAGATTGTAAACCAGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_014574.3-2010s21c1
Sequence:CCGGTCATATCAACAGAGTAGTAAGCTCGAGCTTACTACTCTGTTGATATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_014574.3-805s21c1
Sequence:CCGGTCTCAGCGGGTAAGGTCATTACTCGAGTAATGACCTTACCCGCTGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365162    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_014574.3-2594s21c1
Sequence:CCGGGATGTGAACTGAGCGTATATCCTCGAGGATATACGCTCAGTTCACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014574.2-1323s1c1
Sequence:CCGGGCCTGCTAATAAAGATGCCTTCTCGAGAAGGCATCTTTATTAGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014574.2-2026s1c1
Sequence:CCGGCCTGTTACAATAACTGCTCATCTCGAGATGAGCAGTTATTGTAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014574.2-1681s1c1
Sequence:CCGGGCTGGCACTTTAGTTGGTCATCTCGAGATGACCAACTAAAGTGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014574.2-481s1c1
Sequence:CCGGGCCCGGATTGCATTTCTACAACTCGAGTTGTAGAAATGCAATCCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014574.2-1502s1c1
Sequence:CCGGCCTCTTTAGATGTAGAGCCTACTCGAGTAGGCTCTACATCTAAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014574
VALIDATED
STRN3 MISSION shRNA shRNA Plasmid DNA
striatin, calmodulin binding protein 3
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000377467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014574.3-944s21c1
Sequence:CCGGATGTTCTTGAGACGTTCAATTCTCGAGAATTGAACGTCTCAAGAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365147    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_014574.3-2157s21c1
Sequence:CCGGAGATCCTAATGGAATCTATTTCTCGAGAAATAGATTCCATTAGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_014574.3-1987s21c1
Sequence:CCGGGATTCTGGTTTACAATCTAATCTCGAGATTAGATTGTAAACCAGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_014574.3-2010s21c1
Sequence:CCGGTCATATCAACAGAGTAGTAAGCTCGAGCTTACTACTCTGTTGATATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_014574.3-805s21c1
Sequence:CCGGTCTCAGCGGGTAAGGTCATTACTCGAGTAATGACCTTACCCGCTGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365162    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_014574.3-2594s21c1
Sequence:CCGGGATGTGAACTGAGCGTATATCCTCGAGGATATACGCTCAGTTCACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014574.2-1323s1c1
Sequence:CCGGGCCTGCTAATAAAGATGCCTTCTCGAGAAGGCATCTTTATTAGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014574.2-2026s1c1
Sequence:CCGGCCTGTTACAATAACTGCTCATCTCGAGATGAGCAGTTATTGTAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014574.2-1681s1c1
Sequence:CCGGGCTGGCACTTTAGTTGGTCATCTCGAGATGACCAACTAAAGTGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014574.2-481s1c1
Sequence:CCGGGCCCGGATTGCATTTCTACAACTCGAGTTGTAGAAATGCAATCCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014574.2-1502s1c1
Sequence:CCGGCCTCTTTAGATGTAGAGCCTACTCGAGTAGGCTCTACATCTAAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014574
VALIDATED
STRN3 MISSION shRNA Lentiviral Transduction Particles
striatin, calmodulin binding protein 3
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000377467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014574.3-944s21c1
Sequence:CCGGATGTTCTTGAGACGTTCAATTCTCGAGAATTGAACGTCTCAAGAACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365147    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_014574.3-2157s21c1
Sequence:CCGGAGATCCTAATGGAATCTATTTCTCGAGAAATAGATTCCATTAGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_014574.3-1987s21c1
Sequence:CCGGGATTCTGGTTTACAATCTAATCTCGAGATTAGATTGTAAACCAGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_014574.3-2010s21c1
Sequence:CCGGTCATATCAACAGAGTAGTAAGCTCGAGCTTACTACTCTGTTGATATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_014574.3-805s21c1
Sequence:CCGGTCTCAGCGGGTAAGGTCATTACTCGAGTAATGACCTTACCCGCTGAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365162    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_014574.3-2594s21c1
Sequence:CCGGGATGTGAACTGAGCGTATATCCTCGAGGATATACGCTCAGTTCACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014574.2-1323s1c1
Sequence:CCGGGCCTGCTAATAAAGATGCCTTCTCGAGAAGGCATCTTTATTAGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014574.2-2026s1c1
Sequence:CCGGCCTGTTACAATAACTGCTCATCTCGAGATGAGCAGTTATTGTAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_014574.2-1681s1c1
Sequence:CCGGGCTGGCACTTTAGTTGGTCATCTCGAGATGACCAACTAAAGTGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014574.2-481s1c1
Sequence:CCGGGCCCGGATTGCATTTCTACAACTCGAGTTGTAGAAATGCAATCCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036953    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014574.2-1502s1c1
Sequence:CCGGCCTCTTTAGATGTAGAGCCTACTCGAGTAGGCTCTACATCTAAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_052973
VALIDATED
STRN3 MISSION shRNA Bacterial Glycerol Stock
striatin, calmodulin binding protein 3
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000335384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_052973.1-2049s21c1
Sequence:CCGGGCCATGTGTTTGCACTTACAACTCGAGTTGTAAGTGCAAACACATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052973.1-1570s21c1
Sequence:CCGGCCTGCCAATAAAGATGCCTTTCTCGAGAAAGGCATCTTTATTGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000335452    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_052973.1-2795s21c1
Sequence:CCGGCTCCAGTATCTGTGCCCTATACTCGAGTATAGGGCACAGATACTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363788    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_052973.1-1927s21c1
Sequence:CCGGGCTGGCACTTTAGTTGCTCATCTCGAGATGAGCAACTAAAGTGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375064    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_052973.1-2148s21c1
Sequence:CCGGCACTGGTAGTGCGGTAATTTACTCGAGTAAATTACCGCACTACCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375117    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_052973.1-713s21c1
Sequence:CCGGAGCAAGGCAGACAGCTATTAACTCGAGTTAATAGCTGTCTGCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_052973.1-1570s1c1
Sequence:CCGGCCTGCCAATAAAGATGCCTTTCTCGAGAAAGGCATCTTTATTGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075625    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_052973.1-2049s1c1
Sequence:CCGGGCCATGTGTTTGCACTTACAACTCGAGTTGTAAGTGCAAACACATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075623    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_052973.1-2795s1c1
Sequence:CCGGCTCCAGTATCTGTGCCCTATACTCGAGTATAGGGCACAGATACTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_052973.1-1569s1c1
Sequence:CCGGGCCTGCCAATAAAGATGCCTTCTCGAGAAGGCATCTTTATTGGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075627    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_052973.1-1927s1c1
Sequence:CCGGGCTGGCACTTTAGTTGCTCATCTCGAGATGAGCAACTAAAGTGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_052973
VALIDATED
STRN3 MISSION shRNA shRNA Plasmid DNA
striatin, calmodulin binding protein 3
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000335384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_052973.1-2049s21c1
Sequence:CCGGGCCATGTGTTTGCACTTACAACTCGAGTTGTAAGTGCAAACACATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052973.1-1570s21c1
Sequence:CCGGCCTGCCAATAAAGATGCCTTTCTCGAGAAAGGCATCTTTATTGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000335452    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_052973.1-2795s21c1
Sequence:CCGGCTCCAGTATCTGTGCCCTATACTCGAGTATAGGGCACAGATACTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363788    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_052973.1-1927s21c1
Sequence:CCGGGCTGGCACTTTAGTTGCTCATCTCGAGATGAGCAACTAAAGTGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375064    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_052973.1-2148s21c1
Sequence:CCGGCACTGGTAGTGCGGTAATTTACTCGAGTAAATTACCGCACTACCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375117    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_052973.1-713s21c1
Sequence:CCGGAGCAAGGCAGACAGCTATTAACTCGAGTTAATAGCTGTCTGCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_052973.1-1570s1c1
Sequence:CCGGCCTGCCAATAAAGATGCCTTTCTCGAGAAAGGCATCTTTATTGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075625    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_052973.1-2049s1c1
Sequence:CCGGGCCATGTGTTTGCACTTACAACTCGAGTTGTAAGTGCAAACACATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075623    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_052973.1-2795s1c1
Sequence:CCGGCTCCAGTATCTGTGCCCTATACTCGAGTATAGGGCACAGATACTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_052973.1-1569s1c1
Sequence:CCGGGCCTGCCAATAAAGATGCCTTCTCGAGAAGGCATCTTTATTGGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075627    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_052973.1-1927s1c1
Sequence:CCGGGCTGGCACTTTAGTTGCTCATCTCGAGATGAGCAACTAAAGTGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_052973
VALIDATED
STRN3 MISSION shRNA Lentiviral Transduction Particles
striatin, calmodulin binding protein 3
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000335384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_052973.1-2049s21c1
Sequence:CCGGGCCATGTGTTTGCACTTACAACTCGAGTTGTAAGTGCAAACACATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335383    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052973.1-1570s21c1
Sequence:CCGGCCTGCCAATAAAGATGCCTTTCTCGAGAAAGGCATCTTTATTGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000335452    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_052973.1-2795s21c1
Sequence:CCGGCTCCAGTATCTGTGCCCTATACTCGAGTATAGGGCACAGATACTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363788    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_052973.1-1927s21c1
Sequence:CCGGGCTGGCACTTTAGTTGCTCATCTCGAGATGAGCAACTAAAGTGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375064    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_052973.1-2148s21c1
Sequence:CCGGCACTGGTAGTGCGGTAATTTACTCGAGTAAATTACCGCACTACCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375117    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_052973.1-713s21c1
Sequence:CCGGAGCAAGGCAGACAGCTATTAACTCGAGTTAATAGCTGTCTGCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075624    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_052973.1-1570s1c1
Sequence:CCGGCCTGCCAATAAAGATGCCTTTCTCGAGAAAGGCATCTTTATTGGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075625    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_052973.1-2049s1c1
Sequence:CCGGGCCATGTGTTTGCACTTACAACTCGAGTTGTAAGTGCAAACACATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075623    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_052973.1-2795s1c1
Sequence:CCGGCTCCAGTATCTGTGCCCTATACTCGAGTATAGGGCACAGATACTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_052973.1-1569s1c1
Sequence:CCGGGCCTGCCAATAAAGATGCCTTCTCGAGAAGGCATCTTTATTGGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075627    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_052973.1-1927s1c1
Sequence:CCGGGCTGGCACTTTAGTTGCTCATCTCGAGATGAGCAACTAAAGTGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks