EMAIL THIS PAGE TO A FRIEND

STRN4

striatin, calmodulin binding protein 4

Synonyms: ZIN zinedin
UniProtKB ID: Q9NRL3, Q8NE53
Gene ID:
Mouse(97387) striatin, calmodulin binding protein 4
Rat(308392) striatin, calmodulin binding protein 4
cow(506040) striatin, calmodulin binding protein 4
sheep(101121963) striatin, calmodulin binding protein 4
naked mole-rat(101720977) striatin, calmodulin binding protein 4
Domestic Rabbit(100356157) striatin, calmodulin binding protein 4
domestic guinea pig(100717340) striatin, calmodulin binding protein 4
Zebrafish(562780) striatin, calmodulin binding protein 4
domestic cat(101099851) striatin, calmodulin binding protein 4
dog(610799) striatin, calmodulin binding protein 4
77 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_133789 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133789 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133789 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_013403 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_013403 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_013403 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU160111 MISSION® esiRNA esiRNA human STRN4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001039877 Rosetta Predictions human pricing
NM_013403 Rosetta Predictions human pricing
NM_001107480 Rosetta Predictions rat pricing
NM_001039878 Rosetta Predictions mouse pricing
NM_133789 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039877 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00090736 predicted 898
2 SASI_Hs01_00090737 predicted 765
3 SASI_Hs02_00308694 predicted 901
4 SASI_Hs01_00090738 predicted 741
5 SASI_Hs01_00090739 predicted 1968
6 SASI_Hs01_00090740 predicted 405
7 SASI_Hs01_00090742 predicted 2567
8 SASI_Hs01_00090743 predicted 1535
9 SASI_Hs02_00308695 predicted 2127
10 SASI_Hs01_00090745 predicted 1958
11 SASI_Hs01_00090741 predicted 1432
12 SASI_Hs01_00090744 predicted 2197
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013403 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00127155 predicted 900
2 SASI_Hs01_00127156 predicted 759
3 SASI_Hs02_00344786 predicted 900
4 SASI_Hs01_00127157 predicted 740
5 SASI_Hs01_00127158 predicted 1950
6 SASI_Hs01_00127159 predicted 404
7 SASI_Hs01_00127161 predicted 2541
8 SASI_Hs01_00127162 predicted 1521
9 SASI_Hs02_00344787 predicted 2097
10 SASI_Hs01_00127164 predicted 1932
11 SASI_Hs01_00127160 predicted 1417
12 SASI_Hs01_00127163 predicted 2175
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107480 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00229245 predicted 1489
2 SASI_Rn02_00229246 predicted 1389
3 SASI_Rn02_00229247 predicted 2193
4 SASI_Rn02_00229248 predicted 1483
5 SASI_Rn02_00229249 predicted 1236
6 SASI_Rn02_00229250 predicted 2578
7 SASI_Rn02_00229251 predicted 809
8 SASI_Rn02_00229252 predicted 2403
9 SASI_Rn02_00229253 predicted 1751
10 SASI_Rn02_00229254 predicted 2609
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039878 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00146872 predicted 2111
2 SASI_Mm01_00146873 predicted 433
3 SASI_Mm01_00146874 predicted 607
4 SASI_Mm01_00146875 predicted 391
5 SASI_Mm01_00146876 predicted 2157
6 SASI_Mm01_00146877 predicted 486
7 SASI_Mm01_00146878 predicted 782
8 SASI_Mm01_00146879 predicted 2398
9 SASI_Mm02_00290241 predicted 580
10 SASI_Mm01_00146881 predicted 2050
11 SASI_Mm01_00146880 predicted 1597
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133789 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00092516 predicted 2125
2 SASI_Mm01_00092517 predicted 431
3 SASI_Mm01_00092518 predicted 602
4 SASI_Mm01_00092519 predicted 387
5 SASI_Mm01_00092520 predicted 2174
6 SASI_Mm01_00092521 predicted 484
7 SASI_Mm01_00092522 predicted 780
8 SASI_Mm01_00092523 predicted 2413
9 SASI_Mm02_00338815 predicted 578
10 SASI_Mm01_00092525 predicted 2071
11 SASI_Mm01_00092524 predicted 1619
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133789
VALIDATED
STRN4 MISSION shRNA Bacterial Glycerol Stock
striatin, calmodulin binding protein 4
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000075628    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133789.1-3343s1c1
Sequence:CCGGCCACGTTATCACTGTGTGATACTCGAGTATCACACAGTGATAACGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133789.1-2581s1c1
Sequence:CCGGACGACTGTTCTCTGCGTTTATCTCGAGATAAACGCAGAGAACAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133789.1-2557s1c1
Sequence:CCGGGCGTGTTCTTGATGTCAGGAACTCGAGTTCCTGACATCAAGAACACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075630    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133789.1-2474s1c1
Sequence:CCGGCCTGGACAATCGAACAGGTAACTCGAGTTACCTGTTCGATTGTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075629    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133789.1-2308s1c1
Sequence:CCGGCCTCCTTTCGTTCTGGTGATACTCGAGTATCACCAGAACGAAAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133789.2-2164s21c1
Sequence:CCGGACGACTGTTCTCTGCGTTTATCTCGAGATAAACGCAGAGAACAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133789.2-2057s21c1
Sequence:CCGGCCTGGACAATCGAACAGGTAACTCGAGTTACCTGTTCGATTGTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133789.2-1891s21c1
Sequence:CCGGCCTCCTTTCGTTCTGGTGATACTCGAGTATCACCAGAACGAAAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000327468    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133789.2-2926s21c1
Sequence:CCGGCCACGTTATCACTGTGTGATACTCGAGTATCACACAGTGATAACGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133789
VALIDATED
STRN4 MISSION shRNA shRNA Plasmid DNA
striatin, calmodulin binding protein 4
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000075628    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133789.1-3343s1c1
Sequence:CCGGCCACGTTATCACTGTGTGATACTCGAGTATCACACAGTGATAACGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133789.1-2581s1c1
Sequence:CCGGACGACTGTTCTCTGCGTTTATCTCGAGATAAACGCAGAGAACAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133789.1-2557s1c1
Sequence:CCGGGCGTGTTCTTGATGTCAGGAACTCGAGTTCCTGACATCAAGAACACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075630    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133789.1-2474s1c1
Sequence:CCGGCCTGGACAATCGAACAGGTAACTCGAGTTACCTGTTCGATTGTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075629    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133789.1-2308s1c1
Sequence:CCGGCCTCCTTTCGTTCTGGTGATACTCGAGTATCACCAGAACGAAAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133789.2-2164s21c1
Sequence:CCGGACGACTGTTCTCTGCGTTTATCTCGAGATAAACGCAGAGAACAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133789.2-2057s21c1
Sequence:CCGGCCTGGACAATCGAACAGGTAACTCGAGTTACCTGTTCGATTGTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133789.2-1891s21c1
Sequence:CCGGCCTCCTTTCGTTCTGGTGATACTCGAGTATCACCAGAACGAAAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000327468    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133789.2-2926s21c1
Sequence:CCGGCCACGTTATCACTGTGTGATACTCGAGTATCACACAGTGATAACGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133789
VALIDATED
STRN4 MISSION shRNA Lentiviral Transduction Particles
striatin, calmodulin binding protein 4
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000075628    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133789.1-3343s1c1
Sequence:CCGGCCACGTTATCACTGTGTGATACTCGAGTATCACACAGTGATAACGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075631    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133789.1-2581s1c1
Sequence:CCGGACGACTGTTCTCTGCGTTTATCTCGAGATAAACGCAGAGAACAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075632    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133789.1-2557s1c1
Sequence:CCGGGCGTGTTCTTGATGTCAGGAACTCGAGTTCCTGACATCAAGAACACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075630    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133789.1-2474s1c1
Sequence:CCGGCCTGGACAATCGAACAGGTAACTCGAGTTACCTGTTCGATTGTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075629    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133789.1-2308s1c1
Sequence:CCGGCCTCCTTTCGTTCTGGTGATACTCGAGTATCACCAGAACGAAAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133789.2-2164s21c1
Sequence:CCGGACGACTGTTCTCTGCGTTTATCTCGAGATAAACGCAGAGAACAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133789.2-2057s21c1
Sequence:CCGGCCTGGACAATCGAACAGGTAACTCGAGTTACCTGTTCGATTGTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327469    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133789.2-1891s21c1
Sequence:CCGGCCTCCTTTCGTTCTGGTGATACTCGAGTATCACCAGAACGAAAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000327468    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133789.2-2926s21c1
Sequence:CCGGCCACGTTATCACTGTGTGATACTCGAGTATCACACAGTGATAACGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013403
STRN4 MISSION shRNA Bacterial Glycerol Stock
striatin, calmodulin binding protein 4
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000036954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013403.1-349s1c1
Sequence:CCGGCGGATCAAGATGCTAGAGTATCTCGAGATACTCTAGCATCTTGATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013403.1-1839s1c1
Sequence:CCGGCGACACCGTCTTGTATGACATCTCGAGATGTCATACAAGACGGTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013403.1-937s1c1
Sequence:CCGGGAGGATGCTATCAATGAGTTTCTCGAGAAACTCATTGATAGCATCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013403.1-1923s1c1
Sequence:CCGGCCAAGTGGTGAGTCATCCAAACTCGAGTTTGGATGACTCACCACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013403.1-1432s1c1
Sequence:CCGGGCGCTAGATGTGGAACCTATACTCGAGTATAGGTTCCACATCTAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433556    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013403.2-2606s21c1
Sequence:CCGGGGGTGTCTTTAGGGATCAGTTCTCGAGAACTGATCCCTAAAGACACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013403.2-1598s21c1
Sequence:CCGGACCTCAGCATGGATCCCTATGCTCGAGCATAGGGATCCATGCTGAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013403
STRN4 MISSION shRNA shRNA Plasmid DNA
striatin, calmodulin binding protein 4
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000036954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013403.1-349s1c1
Sequence:CCGGCGGATCAAGATGCTAGAGTATCTCGAGATACTCTAGCATCTTGATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013403.1-1839s1c1
Sequence:CCGGCGACACCGTCTTGTATGACATCTCGAGATGTCATACAAGACGGTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013403.1-937s1c1
Sequence:CCGGGAGGATGCTATCAATGAGTTTCTCGAGAAACTCATTGATAGCATCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013403.1-1923s1c1
Sequence:CCGGCCAAGTGGTGAGTCATCCAAACTCGAGTTTGGATGACTCACCACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013403.1-1432s1c1
Sequence:CCGGGCGCTAGATGTGGAACCTATACTCGAGTATAGGTTCCACATCTAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433556    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013403.2-2606s21c1
Sequence:CCGGGGGTGTCTTTAGGGATCAGTTCTCGAGAACTGATCCCTAAAGACACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013403.2-1598s21c1
Sequence:CCGGACCTCAGCATGGATCCCTATGCTCGAGCATAGGGATCCATGCTGAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013403
STRN4 MISSION shRNA Lentiviral Transduction Particles
striatin, calmodulin binding protein 4
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000036954    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013403.1-349s1c1
Sequence:CCGGCGGATCAAGATGCTAGAGTATCTCGAGATACTCTAGCATCTTGATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036957    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013403.1-1839s1c1
Sequence:CCGGCGACACCGTCTTGTATGACATCTCGAGATGTCATACAAGACGGTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036958    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013403.1-937s1c1
Sequence:CCGGGAGGATGCTATCAATGAGTTTCTCGAGAAACTCATTGATAGCATCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036956    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013403.1-1923s1c1
Sequence:CCGGCCAAGTGGTGAGTCATCCAAACTCGAGTTTGGATGACTCACCACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036955    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013403.1-1432s1c1
Sequence:CCGGGCGCTAGATGTGGAACCTATACTCGAGTATAGGTTCCACATCTAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433556    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_013403.2-2606s21c1
Sequence:CCGGGGGTGTCTTTAGGGATCAGTTCTCGAGAACTGATCCCTAAAGACACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416321    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013403.2-1598s21c1
Sequence:CCGGACCTCAGCATGGATCCCTATGCTCGAGCATAGGGATCCATGCTGAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks