EMAIL THIS PAGE TO A FRIEND

STRN

striatin, calmodulin binding protein

Synonyms: SG2NA
UniProtKB ID: O43815, Q3KP65, Q53TQ8, Q9NP38
Gene ID:
Mouse(268980) striatin, calmodulin binding protein
Rat(29149) striatin, calmodulin binding protein
cow(537010) striatin, calmodulin binding protein
sheep(101122771) striatin, calmodulin binding protein
naked mole-rat(101722720) striatin, calmodulin binding protein
domestic guinea pig(100735204) striatin, calmodulin binding protein
chicken(421470) striatin, calmodulin binding protein
dog(100683096) striatin, calmodulin binding protein
Horse(100054418) striatin, calmodulin binding protein
domestic cat(101082999) striatin, calmodulin binding protein
120 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011500 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011500 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011500 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003162 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003162 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003162 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU135831 MISSION® esiRNA esiRNA human STRN (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003162 Rosetta Predictions human pricing
NM_019148 Rosetta Predictions rat pricing
XM_579422 Rosetta Predictions rat pricing
NM_011500 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003162 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00165261 predicted 1785
2 SASI_Hs01_00165262 predicted 2179
3 SASI_Hs01_00165264 predicted 2267
4 SASI_Hs01_00165265 predicted 1957
5 SASI_Hs01_00165266 predicted 970
6 SASI_Hs01_00165267 predicted 1596
7 SASI_Hs02_00335171 predicted 1889
8 SASI_Hs02_00335172 predicted 790
9 SASI_Hs01_00165268 predicted 1658
10 SASI_Hs01_00165269 predicted 1037
11 SASI_Hs01_00165263 predicted 527
12 SASI_Hs01_00165270 predicted 2241
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019148 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00103850 predicted 1991
2 SASI_Rn01_00103851 predicted 562
3 SASI_Rn01_00103852 predicted 382
4 SASI_Rn01_00103853 predicted 1337
5 SASI_Rn02_00261919 predicted 2212
6 SASI_Rn01_00103855 predicted 1229
7 SASI_Rn01_00103856 predicted 1736
8 SASI_Rn01_00103857 predicted 2001
9 SASI_Rn01_00103858 predicted 1922
10 SASI_Rn01_00103859 predicted 1111
11 SASI_Rn01_00103854 predicted 1040
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579422 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00149047 predicted 1988
2 SASI_Rn01_00149048 predicted 565
3 SASI_Rn01_00149049 predicted 379
4 SASI_Rn01_00149050 predicted 413
5 SASI_Rn01_00149051 predicted 1335
6 SASI_Rn01_00149052 predicted 428
7 SASI_Rn01_00149053 predicted 396
8 SASI_Rn01_00149054 predicted 1234
9 SASI_Rn01_00149055 predicted 1739
10 SASI_Rn01_00149056 predicted 2251
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011500 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00176097 predicted 849
2 SASI_Mm01_00176098 predicted 408
3 SASI_Mm01_00176099 predicted 431
4 SASI_Mm01_00176100 predicted 2235
5 SASI_Mm01_00176101 predicted 2260
6 SASI_Mm01_00176102 predicted 1244
7 SASI_Mm01_00176103 predicted 1730
8 SASI_Mm01_00176104 predicted 2478
9 SASI_Mm01_00176105 predicted 1953
10 SASI_Mm01_00176106 predicted 1102
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011500
VALIDATED
STRN MISSION shRNA Bacterial Glycerol Stock
striatin, calmodulin binding protein
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000120227    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011500.1-2356s1c1
Sequence:CCGGGCTTCACCTTGTAGCTCTTTACTCGAGTAAAGAGCTACAAGGTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011500.1-2280s1c1
Sequence:CCGGCCACCCTTCCAAGTGCTATATCTCGAGATATAGCACTTGGAAGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011500.1-1303s1c1
Sequence:CCGGGCAGACTCACTAGCTTATGATCTCGAGATCATAAGCTAGTGAGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011500.1-824s1c1
Sequence:CCGGCCAGTGAAGATCGAGACACAACTCGAGTTGTGTCTCGATCTTCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_011500.2-2355s21c1
Sequence:CCGGACCCTTCCAAATGCTATATAGCTCGAGCTATATAGCATTTGGAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011500.2-2259s21c1
Sequence:CCGGCAATACGCTTATGGAATTTAGCTCGAGCTAAATTCCATAAGCGTATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_011500.2-579s21c1
Sequence:CCGGTCGGCTACACAGATACTATTCCTCGAGGAATAGTATCTGTGTAGCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_011500.2-1388s21c1
Sequence:CCGGGCTTATGATATAGCGAATAACCTCGAGGTTATTCGCTATATCATAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_011500.2-1839s21c1
Sequence:CCGGCAGACGGCACTCTTCGCTTATCTCGAGATAAGCGAAGAGTGCCGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374579    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_011500.2-1135s21c1
Sequence:CCGGACAAGATATGCTTGCTAATTTCTCGAGAAATTAGCAAGCATATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011500
VALIDATED
STRN MISSION shRNA shRNA Plasmid DNA
striatin, calmodulin binding protein
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000120227    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011500.1-2356s1c1
Sequence:CCGGGCTTCACCTTGTAGCTCTTTACTCGAGTAAAGAGCTACAAGGTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011500.1-2280s1c1
Sequence:CCGGCCACCCTTCCAAGTGCTATATCTCGAGATATAGCACTTGGAAGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011500.1-1303s1c1
Sequence:CCGGGCAGACTCACTAGCTTATGATCTCGAGATCATAAGCTAGTGAGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011500.1-824s1c1
Sequence:CCGGCCAGTGAAGATCGAGACACAACTCGAGTTGTGTCTCGATCTTCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_011500.2-2355s21c1
Sequence:CCGGACCCTTCCAAATGCTATATAGCTCGAGCTATATAGCATTTGGAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011500.2-2259s21c1
Sequence:CCGGCAATACGCTTATGGAATTTAGCTCGAGCTAAATTCCATAAGCGTATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_011500.2-579s21c1
Sequence:CCGGTCGGCTACACAGATACTATTCCTCGAGGAATAGTATCTGTGTAGCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_011500.2-1388s21c1
Sequence:CCGGGCTTATGATATAGCGAATAACCTCGAGGTTATTCGCTATATCATAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_011500.2-1839s21c1
Sequence:CCGGCAGACGGCACTCTTCGCTTATCTCGAGATAAGCGAAGAGTGCCGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374579    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_011500.2-1135s21c1
Sequence:CCGGACAAGATATGCTTGCTAATTTCTCGAGAAATTAGCAAGCATATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011500
VALIDATED
STRN MISSION shRNA Lentiviral Transduction Particles
striatin, calmodulin binding protein
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000120227    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011500.1-2356s1c1
Sequence:CCGGGCTTCACCTTGTAGCTCTTTACTCGAGTAAAGAGCTACAAGGTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011500.1-2280s1c1
Sequence:CCGGCCACCCTTCCAAGTGCTATATCTCGAGATATAGCACTTGGAAGGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011500.1-1303s1c1
Sequence:CCGGGCAGACTCACTAGCTTATGATCTCGAGATCATAAGCTAGTGAGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011500.1-824s1c1
Sequence:CCGGCCAGTGAAGATCGAGACACAACTCGAGTTGTGTCTCGATCTTCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_011500.2-2355s21c1
Sequence:CCGGACCCTTCCAAATGCTATATAGCTCGAGCTATATAGCATTTGGAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011500.2-2259s21c1
Sequence:CCGGCAATACGCTTATGGAATTTAGCTCGAGCTAAATTCCATAAGCGTATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_011500.2-579s21c1
Sequence:CCGGTCGGCTACACAGATACTATTCCTCGAGGAATAGTATCTGTGTAGCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366142    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_011500.2-1388s21c1
Sequence:CCGGGCTTATGATATAGCGAATAACCTCGAGGTTATTCGCTATATCATAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366141    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_011500.2-1839s21c1
Sequence:CCGGCAGACGGCACTCTTCGCTTATCTCGAGATAAGCGAAGAGTGCCGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374579    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_011500.2-1135s21c1
Sequence:CCGGACAAGATATGCTTGCTAATTTCTCGAGAAATTAGCAAGCATATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003162
STRN MISSION shRNA Bacterial Glycerol Stock
striatin, calmodulin binding protein
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000036944    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003162.1-2637s1c1
Sequence:CCGGGCCTGAGCGAATACAAGTTTACTCGAGTAAACTTGTATTCGCTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003162.1-833s1c1
Sequence:CCGGGCGGTGAAGATCGAGATACAACTCGAGTTGTATCTCGATCTTCACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003162.1-786s1c1
Sequence:CCGGCGTCATTGATACTTCAACAATCTCGAGATTGTTGAAGTATCAATGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003162.1-1913s1c1
Sequence:CCGGGCAAGGGATATACAAGCATTTCTCGAGAAATGCTTGTATATCCCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003162.1-2120s1c1
Sequence:CCGGCCCACCTAGAAGCTGTTACAACTCGAGTTGTAACAGCTTCTAGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003162.2-977s21c1
Sequence:CCGGATGTGGACCAGGGAGTAATTACTCGAGTAATTACTCCCTGGTCCACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003162.2-1520s21c1
Sequence:CCGGTTGATGTAGAACCTATCTATACTCGAGTATAGATAGGTTCTACATCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419015    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003162.2-1775s21c1
Sequence:CCGGCAGATGGCACTCTGCGTTTATCTCGAGATAAACGCAGAGTGCCATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003162.2-1192s21c1
Sequence:CCGGGAAGTGGAAGCATTGACATTTCTCGAGAAATGTCAATGCTTCCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003162
STRN MISSION shRNA shRNA Plasmid DNA
striatin, calmodulin binding protein
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000036944    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003162.1-2637s1c1
Sequence:CCGGGCCTGAGCGAATACAAGTTTACTCGAGTAAACTTGTATTCGCTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003162.1-833s1c1
Sequence:CCGGGCGGTGAAGATCGAGATACAACTCGAGTTGTATCTCGATCTTCACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003162.1-786s1c1
Sequence:CCGGCGTCATTGATACTTCAACAATCTCGAGATTGTTGAAGTATCAATGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003162.1-1913s1c1
Sequence:CCGGGCAAGGGATATACAAGCATTTCTCGAGAAATGCTTGTATATCCCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003162.1-2120s1c1
Sequence:CCGGCCCACCTAGAAGCTGTTACAACTCGAGTTGTAACAGCTTCTAGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003162.2-977s21c1
Sequence:CCGGATGTGGACCAGGGAGTAATTACTCGAGTAATTACTCCCTGGTCCACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003162.2-1520s21c1
Sequence:CCGGTTGATGTAGAACCTATCTATACTCGAGTATAGATAGGTTCTACATCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419015    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003162.2-1775s21c1
Sequence:CCGGCAGATGGCACTCTGCGTTTATCTCGAGATAAACGCAGAGTGCCATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003162.2-1192s21c1
Sequence:CCGGGAAGTGGAAGCATTGACATTTCTCGAGAAATGTCAATGCTTCCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003162
STRN MISSION shRNA Lentiviral Transduction Particles
striatin, calmodulin binding protein
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000036944    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003162.1-2637s1c1
Sequence:CCGGGCCTGAGCGAATACAAGTTTACTCGAGTAAACTTGTATTCGCTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003162.1-833s1c1
Sequence:CCGGGCGGTGAAGATCGAGATACAACTCGAGTTGTATCTCGATCTTCACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003162.1-786s1c1
Sequence:CCGGCGTCATTGATACTTCAACAATCTCGAGATTGTTGAAGTATCAATGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003162.1-1913s1c1
Sequence:CCGGGCAAGGGATATACAAGCATTTCTCGAGAAATGCTTGTATATCCCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003162.1-2120s1c1
Sequence:CCGGCCCACCTAGAAGCTGTTACAACTCGAGTTGTAACAGCTTCTAGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003162.2-977s21c1
Sequence:CCGGATGTGGACCAGGGAGTAATTACTCGAGTAATTACTCCCTGGTCCACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003162.2-1520s21c1
Sequence:CCGGTTGATGTAGAACCTATCTATACTCGAGTATAGATAGGTTCTACATCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419015    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003162.2-1775s21c1
Sequence:CCGGCAGATGGCACTCTGCGTTTATCTCGAGATAAACGCAGAGTGCCATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429946    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003162.2-1192s21c1
Sequence:CCGGGAAGTGGAAGCATTGACATTTCTCGAGAAATGTCAATGCTTCCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks