EMAIL THIS PAGE TO A FRIEND

STS

steroid sulfatase (microsomal), isozyme S

Synonyms: ARSC ARSC1 ASC ES SSDD XLI
UniProtKB ID: P08842, B2RA47
Gene ID:
Human(412) Summary: The protein encoded by this gene catalyzes the conversion of sulfated steroid precursors to estrogens during pregnancy. The encoded protein is found in the endoplasmic reticulum, where it acts as a homodimer. Mutations in this gene are known to cause X-linked ichthyosis (XLI). [provided by RefSeq, Jul 2008]
Mouse(20905) steroid sulfatase
Rat(24800) steroid sulfatase (microsomal), isozyme S
fruit fly(252737) streaked sterni
Horse(100034102) steroid sulfatase (microsomal), isozyme S
domestic cat(101082979) steroid sulfatase (microsomal), isozyme S
dog(491727) steroid sulfatase (microsomal), isozyme S
chicken(418654) steroid sulfatase (microsomal), isozyme S
Zebrafish(402795) steroid sulfatase (microsomal), arylsulfatase C, isozyme S
Thale Cress(828186) stachyose synthase
domestic guinea pig(100712701) steroid sulfatase (microsomal), isozyme S
naked mole-rat(101716720) steroid sulfatase (microsomal), isozyme S
cow(509206) steroid sulfatase (microsomal), isozyme S
sheep(101118590) steroid sulfatase (microsomal), isozyme S
95 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
663727 2,2,2-Trichloroethoxysulfonamide 97% human pricing
06556 Phenyl formate ≥98.0% (GC) human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000351 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000351 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000351 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009293 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009293 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009293 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU004551 MISSION® esiRNA esiRNA targeting human STS (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000351 Rosetta Predictions human pricing
NM_012661 Rosetta Predictions rat pricing
NM_009293 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000351 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00134900 predicted 1221
2 SASI_Hs01_00134901 predicted 307
3 SASI_Hs01_00134902 predicted 1403
4 SASI_Hs02_00302389 predicted 321
5 SASI_Hs01_00134903 predicted 422
6 SASI_Hs01_00134904 predicted 722
7 SASI_Hs01_00134905 predicted 1124
8 SASI_Hs02_00302390 predicted 1203
9 SASI_Hs01_00134906 predicted 1892
10 SASI_Hs01_00134907 predicted 1306
11 SASI_Hs01_00134899 predicted 586
12 SASI_Hs01_00134908 predicted 1389
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012661 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00039805 predicted 1052
2 SASI_Rn01_00039806 predicted 1206
3 SASI_Rn01_00039807 predicted 1048
4 SASI_Rn01_00039808 predicted 2154
5 SASI_Rn01_00039809 predicted 1778
6 SASI_Rn01_00039810 predicted 1515
7 SASI_Rn01_00039811 predicted 871
8 SASI_Rn01_00039812 predicted 1260
9 SASI_Rn01_00039813 predicted 1763
10 SASI_Rn01_00039814 predicted 1273
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009293 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00114441 predicted 1467
2 SASI_Mm01_00114442 predicted 1265
3 SASI_Mm01_00114443 predicted 1270
4 SASI_Mm01_00114444 predicted 1544
5 SASI_Mm01_00114445 predicted 560
6 SASI_Mm01_00114446 predicted 1267
7 SASI_Mm01_00114447 predicted 565
8 SASI_Mm01_00114448 predicted 560
9 SASI_Mm01_00114449 predicted 1368
10 SASI_Mm02_00315816 predicted 1360
11 SASI_Mm01_00114450 predicted 565
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000351
VALIDATED
STS MISSION shRNA Bacterial Glycerol Stock
steroid sulfatase (microsomal), isozyme S
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000430776    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000351.4-2378s21c1
Sequence:CCGGTATGTCAACAGTATAAGTTACCTCGAGGTAACTTATACTGTTGACATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419308    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000351.4-1705s21c1
Sequence:CCGGGCTTCTGTTTCGGGAGTTATGCTCGAGCATAACTCCCGAAACAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000351.4-1437s21c1
Sequence:CCGGACTAGCAACATGGACATATTTCTCGAGAAATATGTCCATGTTGCTAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423367    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000351.4-2422s21c1
Sequence:CCGGATGCAATAACCAGCATAATAACTCGAGTTATTATGCTGGTTATTGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000351.2-671s1c1
Sequence:CCGGCCTTTACATCACGGCTTCAATCTCGAGATTGAAGCCGTGATGTAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000351.2-1202s1c1
Sequence:CCGGGAGCTGAGATTGGCTAATGATCTCGAGATCATTAGCCAATCTCAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000351.2-1096s1c1
Sequence:CCGGCCTGTTCTCCAGCAAAGACTTCTCGAGAAGTCTTTGCTGGAGAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000050830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000351.2-1746s1c1
Sequence:CCGGCCAGAGAGAGAAACCCACTTACTCGAGTAAGTGGGTTTCTCTCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000351
VALIDATED
STS MISSION shRNA shRNA Plasmid DNA
steroid sulfatase (microsomal), isozyme S
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000430776    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000351.4-2378s21c1
Sequence:CCGGTATGTCAACAGTATAAGTTACCTCGAGGTAACTTATACTGTTGACATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419308    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000351.4-1705s21c1
Sequence:CCGGGCTTCTGTTTCGGGAGTTATGCTCGAGCATAACTCCCGAAACAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000351.4-1437s21c1
Sequence:CCGGACTAGCAACATGGACATATTTCTCGAGAAATATGTCCATGTTGCTAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423367    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000351.4-2422s21c1
Sequence:CCGGATGCAATAACCAGCATAATAACTCGAGTTATTATGCTGGTTATTGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000351.2-671s1c1
Sequence:CCGGCCTTTACATCACGGCTTCAATCTCGAGATTGAAGCCGTGATGTAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000351.2-1202s1c1
Sequence:CCGGGAGCTGAGATTGGCTAATGATCTCGAGATCATTAGCCAATCTCAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000351.2-1096s1c1
Sequence:CCGGCCTGTTCTCCAGCAAAGACTTCTCGAGAAGTCTTTGCTGGAGAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000050830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000351.2-1746s1c1
Sequence:CCGGCCAGAGAGAGAAACCCACTTACTCGAGTAAGTGGGTTTCTCTCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000351
VALIDATED
STS MISSION shRNA Lentiviral Transduction Particles
steroid sulfatase (microsomal), isozyme S
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000430776    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000351.4-2378s21c1
Sequence:CCGGTATGTCAACAGTATAAGTTACCTCGAGGTAACTTATACTGTTGACATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419308    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000351.4-1705s21c1
Sequence:CCGGGCTTCTGTTTCGGGAGTTATGCTCGAGCATAACTCCCGAAACAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000351.4-1437s21c1
Sequence:CCGGACTAGCAACATGGACATATTTCTCGAGAAATATGTCCATGTTGCTAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423367    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000351.4-2422s21c1
Sequence:CCGGATGCAATAACCAGCATAATAACTCGAGTTATTATGCTGGTTATTGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000351.2-671s1c1
Sequence:CCGGCCTTTACATCACGGCTTCAATCTCGAGATTGAAGCCGTGATGTAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050832    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000351.2-1202s1c1
Sequence:CCGGGAGCTGAGATTGGCTAATGATCTCGAGATCATTAGCCAATCTCAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050831    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000351.2-1096s1c1
Sequence:CCGGCCTGTTCTCCAGCAAAGACTTCTCGAGAAGTCTTTGCTGGAGAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000050830    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000351.2-1746s1c1
Sequence:CCGGCCAGAGAGAGAAACCCACTTACTCGAGTAAGTGGGTTTCTCTCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009293
STS MISSION shRNA Bacterial Glycerol Stock
steroid sulfatase (microsomal), isozyme S
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000101458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009293.1-1605s1c1
Sequence:CCGGGTTCCACTACTGCAACGCCTACTCGAGTAGGCGTTGCAGTAGTGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009293.1-2094s1c1
Sequence:CCGGCCACGCCACGACACGGACTCACTCGAGTGAGTCCGTGTCGTGGCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009293.1-1140s1c1
Sequence:CCGGGCACGTCCACACCGCGCACTTCTCGAGAAGTGCGCGGTGTGGACGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009293.1-403s1c1
Sequence:CCGGCTCGGCTGCTACGGCAACAAACTCGAGTTTGTTGCCGTAGCAGCCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009293.1-1593s1c1
Sequence:CCGGGCACGAGTTCCTGTTCCACTACTCGAGTAGTGGAACAGGAACTCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009293
STS MISSION shRNA shRNA Plasmid DNA
steroid sulfatase (microsomal), isozyme S
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000101458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009293.1-1605s1c1
Sequence:CCGGGTTCCACTACTGCAACGCCTACTCGAGTAGGCGTTGCAGTAGTGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009293.1-2094s1c1
Sequence:CCGGCCACGCCACGACACGGACTCACTCGAGTGAGTCCGTGTCGTGGCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009293.1-1140s1c1
Sequence:CCGGGCACGTCCACACCGCGCACTTCTCGAGAAGTGCGCGGTGTGGACGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009293.1-403s1c1
Sequence:CCGGCTCGGCTGCTACGGCAACAAACTCGAGTTTGTTGCCGTAGCAGCCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009293.1-1593s1c1
Sequence:CCGGGCACGAGTTCCTGTTCCACTACTCGAGTAGTGGAACAGGAACTCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009293
STS MISSION shRNA Lentiviral Transduction Particles
steroid sulfatase (microsomal), isozyme S
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000101458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009293.1-1605s1c1
Sequence:CCGGGTTCCACTACTGCAACGCCTACTCGAGTAGGCGTTGCAGTAGTGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009293.1-2094s1c1
Sequence:CCGGCCACGCCACGACACGGACTCACTCGAGTGAGTCCGTGTCGTGGCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009293.1-1140s1c1
Sequence:CCGGGCACGTCCACACCGCGCACTTCTCGAGAAGTGCGCGGTGTGGACGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009293.1-403s1c1
Sequence:CCGGCTCGGCTGCTACGGCAACAAACTCGAGTTTGTTGCCGTAGCAGCCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009293.1-1593s1c1
Sequence:CCGGGCACGAGTTCCTGTTCCACTACTCGAGTAGTGGAACAGGAACTCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks