EMAIL THIS PAGE TO A FRIEND

STT3A

STT3A, subunit of the oligosaccharyltransferase complex (catalytic)

Synonyms: ITM1 STT3-A TMC
UniProtKB ID: P46977, Q86XU9, Q8TE35, Q8WUB4
Gene ID:
Mouse(16430) STT3, subunit of the oligosaccharyltransferase complex, homolog A (S. cerevisiae)
Rat(500972) STT3A, subunit of the oligosaccharyltransferase complex (catalytic)
Thale Cress(832089) dolichyl-diphosphooligosaccharide--protein glycosyltransferase subunit STT3A
chicken(374260) STT3, subunit of the oligosaccharyltransferase complex, homolog A (S. cerevisiae)
domestic cat(101083108) STT3, subunit of the oligosaccharyltransferase complex, homolog A (S. cerevisiae)
dog(489300) STT3, subunit of the oligosaccharyltransferase complex, homolog A (S. cerevisiae)
cow(507815) STT3, subunit of the oligosaccharyltransferase complex, homolog A (S. cerevisiae)
sheep(101110978) STT3, subunit of the oligosaccharyltransferase complex, homolog A (S. cerevisiae)
naked mole-rat(101700446) STT3A, subunit of the oligosaccharyltransferase complex (catalytic)
domestic guinea pig(100720801) STT3A, subunit of the oligosaccharyltransferase complex (catalytic)
66 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008408 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008408 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008408 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002219 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002219 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002219 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152713 Rosetta Predictions human pricing
NM_001134749 Rosetta Predictions rat pricing
NM_008408 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152713 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00144659 predicted 2024
2 SASI_Hs01_00144662 predicted 953
3 SASI_Hs01_00144663 predicted 342
4 SASI_Hs01_00144664 predicted 622
5 SASI_Hs01_00144665 predicted 1120
6 SASI_Hs01_00144666 predicted 1389
7 SASI_Hs01_00144667 predicted 721
8 SASI_Hs02_00366610 predicted 954
9 SASI_Hs01_00144668 predicted 1205
10 SASI_Hs02_00366611 predicted 870
11 SASI_Hs01_00144660 predicted 1589
12 SASI_Hs01_00144661 predicted 335
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134749 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00258334 predicted 560
2 SASI_Rn02_00258335 predicted 1935
3 SASI_Rn02_00258336 predicted 1818
4 SASI_Rn02_00258337 predicted 960
5 SASI_Rn02_00258338 predicted 334
6 SASI_Rn02_00258339 predicted 1703
7 SASI_Rn02_00258340 predicted 1987
8 SASI_Rn02_00258341 predicted 1855
9 SASI_Rn02_00258342 predicted 586
10 SASI_Rn02_00258343 predicted 772
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008408 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00164201 predicted 2041
2 SASI_Mm01_00164202 predicted 2050
3 SASI_Mm01_00164203 predicted 1286
4 SASI_Mm01_00164204 predicted 1645
5 SASI_Mm01_00164205 predicted 1785
6 SASI_Mm01_00164206 predicted 928
7 SASI_Mm01_00164209 predicted 2154
8 SASI_Mm01_00164210 predicted 1907
9 SASI_Mm02_00313853 predicted 1183
10 SASI_Mm02_00313854 predicted 738
11 SASI_Mm01_00164207 predicted 1463
12 SASI_Mm01_00164208 predicted 1775
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008408
VALIDATED
STT3A MISSION shRNA Bacterial Glycerol Stock
STT3A, subunit of the oligosaccharyltransferase complex (catalytic)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000093714    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008408.2-3593s1c1
Sequence:CCGGCCGGTGTATGTACTGTGTATTCTCGAGAATACACAGTACATACACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008408.2-875s1c1
Sequence:CCGGCCATTCTTTCTATGCAGATTTCTCGAGAAATCTGCATAGAAAGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008408.2-374s1c1
Sequence:CCGGGCCGAATCATTGGAGGAACAACTCGAGTTGTTCCTCCAATGATTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008408.2-1147s1c1
Sequence:CCGGGCTAAGAATAACATTCCCATTCTCGAGAATGGGAATGTTATTCTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008408.2-375s1c1
Sequence:CCGGCCGAATCATTGGAGGAACAATCTCGAGATTGTTCCTCCAATGATTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008408.4-310s21c1
Sequence:CCGGGCCGAATCATTGGAGGAACAACTCGAGTTGTTCCTCCAATGATTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008408.4-1083s21c1
Sequence:CCGGGCTAAGAATAACATTCCCATTCTCGAGAATGGGAATGTTATTCTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008408.4-811s21c1
Sequence:CCGGCCATTCTTTCTATGCAGATTTCTCGAGAAATCTGCATAGAAAGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305180    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008408.4-2385s21c1
Sequence:CCGGGGCTTTACTTTGGTCAATTAACTCGAGTTAATTGACCAAAGTAAAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008408.4-656s21c1
Sequence:CCGGCAAGTGTGCCCTCGCTTATTTCTCGAGAAATAAGCGAGGGCACACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008408
VALIDATED
STT3A MISSION shRNA shRNA Plasmid DNA
STT3A, subunit of the oligosaccharyltransferase complex (catalytic)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000093714    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008408.2-3593s1c1
Sequence:CCGGCCGGTGTATGTACTGTGTATTCTCGAGAATACACAGTACATACACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008408.2-875s1c1
Sequence:CCGGCCATTCTTTCTATGCAGATTTCTCGAGAAATCTGCATAGAAAGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008408.2-374s1c1
Sequence:CCGGGCCGAATCATTGGAGGAACAACTCGAGTTGTTCCTCCAATGATTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008408.2-1147s1c1
Sequence:CCGGGCTAAGAATAACATTCCCATTCTCGAGAATGGGAATGTTATTCTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008408.2-375s1c1
Sequence:CCGGCCGAATCATTGGAGGAACAATCTCGAGATTGTTCCTCCAATGATTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008408.4-310s21c1
Sequence:CCGGGCCGAATCATTGGAGGAACAACTCGAGTTGTTCCTCCAATGATTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008408.4-1083s21c1
Sequence:CCGGGCTAAGAATAACATTCCCATTCTCGAGAATGGGAATGTTATTCTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008408.4-811s21c1
Sequence:CCGGCCATTCTTTCTATGCAGATTTCTCGAGAAATCTGCATAGAAAGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305180    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008408.4-2385s21c1
Sequence:CCGGGGCTTTACTTTGGTCAATTAACTCGAGTTAATTGACCAAAGTAAAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008408.4-656s21c1
Sequence:CCGGCAAGTGTGCCCTCGCTTATTTCTCGAGAAATAAGCGAGGGCACACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008408
VALIDATED
STT3A MISSION shRNA Lentiviral Transduction Particles
STT3A, subunit of the oligosaccharyltransferase complex (catalytic)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000093714    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_008408.2-3593s1c1
Sequence:CCGGCCGGTGTATGTACTGTGTATTCTCGAGAATACACAGTACATACACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008408.2-875s1c1
Sequence:CCGGCCATTCTTTCTATGCAGATTTCTCGAGAAATCTGCATAGAAAGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093715    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008408.2-374s1c1
Sequence:CCGGGCCGAATCATTGGAGGAACAACTCGAGTTGTTCCTCCAATGATTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093716    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008408.2-1147s1c1
Sequence:CCGGGCTAAGAATAACATTCCCATTCTCGAGAATGGGAATGTTATTCTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008408.2-375s1c1
Sequence:CCGGCCGAATCATTGGAGGAACAATCTCGAGATTGTTCCTCCAATGATTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008408.4-310s21c1
Sequence:CCGGGCCGAATCATTGGAGGAACAACTCGAGTTGTTCCTCCAATGATTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008408.4-1083s21c1
Sequence:CCGGGCTAAGAATAACATTCCCATTCTCGAGAATGGGAATGTTATTCTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008408.4-811s21c1
Sequence:CCGGCCATTCTTTCTATGCAGATTTCTCGAGAAATCTGCATAGAAAGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305180    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008408.4-2385s21c1
Sequence:CCGGGGCTTTACTTTGGTCAATTAACTCGAGTTAATTGACCAAAGTAAAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008408.4-656s21c1
Sequence:CCGGCAAGTGTGCCCTCGCTTATTTCTCGAGAAATAAGCGAGGGCACACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002219
VALIDATED
STT3A MISSION shRNA Bacterial Glycerol Stock
STT3A, subunit of the oligosaccharyltransferase complex (catalytic)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000156036    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002219.1-1091s1c1
Sequence:CCGGCGTTTCTACTCACTGCTGGATCTCGAGATCCAGCAGTGAGTAGAAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002219.1-1628s1c1
Sequence:CCGGGCATATTATTGGCTTCGTCATCTCGAGATGACGAAGCCAATAATATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002219.1-1228s1c1
Sequence:CCGGCCTCTATTACTGCTTTAGCAACTCGAGTTGCTAAAGCAGTAATAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154170    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_002219.1-1508s1c1
Sequence:CCGGCTCATCACCTACACCTTTCATCTCGAGATGAAAGGTGTAGGTGATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153112    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002219.1-398s1c1
Sequence:CCGGGCAATCTACCATGTACTCCATCTCGAGATGGAGTACATGGTAGATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153597    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_002219.1-1643s1c1
Sequence:CCGGCGTCATAATACTCCAGAGGATCTCGAGATCCTCTGGAGTATTATGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002219.1-241s1c1
Sequence:CCGGCCATGAGTTTGATCCGTACTTCTCGAGAAGTACGGATCAAACTCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002219.1-965s1c1
Sequence:CCGGCGCAGCAAGTTGAATCCACAACTCGAGTTGTGGATTCAACTTGCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002219.1-2090s1c1
Sequence:CCGGCGTGTCCGAAATGCTGAGATTCTCGAGAATCTCAGCATTTCGGACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002219
VALIDATED
STT3A MISSION shRNA shRNA Plasmid DNA
STT3A, subunit of the oligosaccharyltransferase complex (catalytic)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000156036    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002219.1-1091s1c1
Sequence:CCGGCGTTTCTACTCACTGCTGGATCTCGAGATCCAGCAGTGAGTAGAAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002219.1-1628s1c1
Sequence:CCGGGCATATTATTGGCTTCGTCATCTCGAGATGACGAAGCCAATAATATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002219.1-1228s1c1
Sequence:CCGGCCTCTATTACTGCTTTAGCAACTCGAGTTGCTAAAGCAGTAATAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154170    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_002219.1-1508s1c1
Sequence:CCGGCTCATCACCTACACCTTTCATCTCGAGATGAAAGGTGTAGGTGATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153112    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002219.1-398s1c1
Sequence:CCGGGCAATCTACCATGTACTCCATCTCGAGATGGAGTACATGGTAGATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153597    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_002219.1-1643s1c1
Sequence:CCGGCGTCATAATACTCCAGAGGATCTCGAGATCCTCTGGAGTATTATGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002219.1-241s1c1
Sequence:CCGGCCATGAGTTTGATCCGTACTTCTCGAGAAGTACGGATCAAACTCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002219.1-965s1c1
Sequence:CCGGCGCAGCAAGTTGAATCCACAACTCGAGTTGTGGATTCAACTTGCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002219.1-2090s1c1
Sequence:CCGGCGTGTCCGAAATGCTGAGATTCTCGAGAATCTCAGCATTTCGGACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002219
VALIDATED
STT3A MISSION shRNA Lentiviral Transduction Particles
STT3A, subunit of the oligosaccharyltransferase complex (catalytic)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000156036    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002219.1-1091s1c1
Sequence:CCGGCGTTTCTACTCACTGCTGGATCTCGAGATCCAGCAGTGAGTAGAAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002219.1-1628s1c1
Sequence:CCGGGCATATTATTGGCTTCGTCATCTCGAGATGACGAAGCCAATAATATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002219.1-1228s1c1
Sequence:CCGGCCTCTATTACTGCTTTAGCAACTCGAGTTGCTAAAGCAGTAATAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154170    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_002219.1-1508s1c1
Sequence:CCGGCTCATCACCTACACCTTTCATCTCGAGATGAAAGGTGTAGGTGATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153112    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002219.1-398s1c1
Sequence:CCGGGCAATCTACCATGTACTCCATCTCGAGATGGAGTACATGGTAGATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153597    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_002219.1-1643s1c1
Sequence:CCGGCGTCATAATACTCCAGAGGATCTCGAGATCCTCTGGAGTATTATGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002219.1-241s1c1
Sequence:CCGGCCATGAGTTTGATCCGTACTTCTCGAGAAGTACGGATCAAACTCATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002219.1-965s1c1
Sequence:CCGGCGCAGCAAGTTGAATCCACAACTCGAGTTGTGGATTCAACTTGCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002219.1-2090s1c1
Sequence:CCGGCGTGTCCGAAATGCTGAGATTCTCGAGAATCTCAGCATTTCGGACACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks