EMAIL THIS PAGE TO A FRIEND

STT3B

STT3B, subunit of the oligosaccharyltransferase complex (catalytic)

Synonyms: SIMP STT3-B
UniProtKB ID: Q8TCJ2, Q96JZ4, Q96KY7
Gene ID:
Human(201595) Summary: The SIMP protein contains a highly immunogenic minor histocompatibility antigen epitope of 9 amino acids, B6(dom1). Like ITM1 (MIM 601134), SIMP is homologous to yeast STT3, an oligosaccharyltransferase essential for cell proliferation (McBride et al., 2002 [PubMed 12439619]
Mouse(68292) STT3, subunit of the oligosaccharyltransferase complex, homolog B (S. cerevisiae)
Rat(363160) STT3B, subunit of the oligosaccharyltransferase complex (catalytic)
domestic guinea pig(100735712) STT3B, subunit of the oligosaccharyltransferase complex (catalytic)
naked mole-rat(101708251) STT3B, subunit of the oligosaccharyltransferase complex (catalytic)
cow(504474) STT3, subunit of the oligosaccharyltransferase complex, homolog B (S. cerevisiae)
sheep(101111133) STT3, subunit of the oligosaccharyltransferase complex, homolog B (S. cerevisiae)
Thale Cress(840312) dolichyl-diphosphooligosaccharide--protein glycosyltransferase subunit STT3B
chicken(428444) STT3, subunit of the oligosaccharyltransferase complex, homolog B (S. cerevisiae)
domestic cat(101092883) STT3, subunit of the oligosaccharyltransferase complex, homolog B (S. cerevisiae)
dog(485628) STT3, subunit of the oligosaccharyltransferase complex, homolog B (S. cerevisiae)
Zebrafish(323918) STT3, subunit of the oligosaccharyltransferase complex, homolog B (S. cerevisiae)
72 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024222 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_024222 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_024222 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_178862 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_178862 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_178862 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_178862 Rosetta Predictions human pricing
XM_343499 Rosetta Predictions rat pricing
XR_005437 Rosetta Predictions rat pricing
XR_009639 Rosetta Predictions rat pricing
NM_024222 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178862 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00084670 predicted 628
2 SASI_Hs01_00084671 predicted 2127
3 SASI_Hs02_00369908 predicted 1310
4 SASI_Hs01_00084672 predicted 414
5 SASI_Hs01_00084674 predicted 1951
6 SASI_Hs02_00369909 predicted 802
7 SASI_Hs01_00084675 predicted 609
8 SASI_Hs01_00084677 predicted 990
9 SASI_Hs01_00084678 predicted 868
10 SASI_Hs02_00369910 predicted 1005
11 SASI_Hs01_00084669 predicted 804
12 SASI_Hs01_00084673 predicted 700
13 SASI_Hs01_00084676 predicted 1190
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_343499 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00172176 predicted 2118
2 SASI_Rn01_00172177 predicted 2346
3 SASI_Rn01_00172178 predicted 1382
4 SASI_Rn01_00172179 predicted 2378
5 SASI_Rn01_00172180 predicted 2029
6 SASI_Rn01_00172181 predicted 1030
7 SASI_Rn01_00172182 predicted 2087
8 SASI_Rn01_00172183 predicted 2299
9 SASI_Rn01_00172184 predicted 2011
10 SASI_Rn01_00172185 predicted 1475
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_005437 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00409214 predicted 3407
2 SASI_Rn02_00409215 predicted 2304
3 SASI_Rn02_00409216 predicted 2530
4 SASI_Rn02_00409217 predicted 1016
5 SASI_Rn02_00409218 predicted 2271
6 SASI_Rn02_00409219 predicted 3514
7 SASI_Rn02_00409220 predicted 2194
8 SASI_Rn02_00409221 predicted 835
9 SASI_Rn02_00409222 predicted 698
10 SASI_Rn02_00409223 predicted 2125
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_009639 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00420562 predicted 3177
2 SASI_Rn02_00420563 predicted 2313
3 SASI_Rn02_00420564 predicted 713
4 SASI_Rn02_00420565 predicted 2051
5 SASI_Rn02_00420566 predicted 1447
6 SASI_Rn02_00420567 predicted 3291
7 SASI_Rn02_00420568 predicted 1971
8 SASI_Rn02_00420569 predicted 527
9 SASI_Rn02_00420570 predicted 403
10 SASI_Rn02_00420571 predicted 1901
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024222 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00141639 predicted 2313
2 SASI_Mm01_00141640 predicted 836
3 SASI_Mm01_00141641 predicted 770
4 SASI_Mm02_00327593 predicted 2148
5 SASI_Mm01_00141643 predicted 1145
6 SASI_Mm01_00141644 predicted 2269
7 SASI_Mm01_00141645 predicted 1053
8 SASI_Mm02_00327594 predicted 690
9 SASI_Mm01_00141647 predicted 665
10 SASI_Mm01_00141648 predicted 706
11 SASI_Mm01_00141642 predicted 1474
12 SASI_Mm01_00141646 predicted 2472
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024222
VALIDATED
STT3B MISSION shRNA Bacterial Glycerol Stock
STT3B, subunit of the oligosaccharyltransferase complex (catalytic)
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000316744    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024222.2-3126s21c1
Sequence:CCGGGCACCAAAGAACCCTCTAATTCTCGAGAATTAGAGGGTTCTTTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316752    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024222.2-2574s21c1
Sequence:CCGGCGAACACGTAATGCTGAGATTCTCGAGAATCTCAGCATTACGTGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024222.2-889s21c1
Sequence:CCGGGCGGCCTTACATCCATATCTACTCGAGTAGATATGGATGTAAGGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000316742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024222.2-804s21c1
Sequence:CCGGGCTGGCCTTATTCATTGGATTCTCGAGAATCCAATGAATAAGGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093704    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024222.2-3126s1c1
Sequence:CCGGGCACCAAAGAACCCTCTAATTCTCGAGAATTAGAGGGTTCTTTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024222.2-1896s1c1
Sequence:CCGGGCAGGTAAAGTGAGGAAGCATCTCGAGATGCTTCCTCACTTTACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093708    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024222.2-2574s1c1
Sequence:CCGGCGAACACGTAATGCTGAGATTCTCGAGAATCTCAGCATTACGTGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024222.2-804s1c1
Sequence:CCGGGCTGGCCTTATTCATTGGATTCTCGAGAATCCAATGAATAAGGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024222.2-889s1c1
Sequence:CCGGGCGGCCTTACATCCATATCTACTCGAGTAGATATGGATGTAAGGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024222
VALIDATED
STT3B MISSION shRNA shRNA Plasmid DNA
STT3B, subunit of the oligosaccharyltransferase complex (catalytic)
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000316744    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024222.2-3126s21c1
Sequence:CCGGGCACCAAAGAACCCTCTAATTCTCGAGAATTAGAGGGTTCTTTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316752    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024222.2-2574s21c1
Sequence:CCGGCGAACACGTAATGCTGAGATTCTCGAGAATCTCAGCATTACGTGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024222.2-889s21c1
Sequence:CCGGGCGGCCTTACATCCATATCTACTCGAGTAGATATGGATGTAAGGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000316742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024222.2-804s21c1
Sequence:CCGGGCTGGCCTTATTCATTGGATTCTCGAGAATCCAATGAATAAGGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093704    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024222.2-3126s1c1
Sequence:CCGGGCACCAAAGAACCCTCTAATTCTCGAGAATTAGAGGGTTCTTTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024222.2-1896s1c1
Sequence:CCGGGCAGGTAAAGTGAGGAAGCATCTCGAGATGCTTCCTCACTTTACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093708    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024222.2-2574s1c1
Sequence:CCGGCGAACACGTAATGCTGAGATTCTCGAGAATCTCAGCATTACGTGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024222.2-804s1c1
Sequence:CCGGGCTGGCCTTATTCATTGGATTCTCGAGAATCCAATGAATAAGGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024222.2-889s1c1
Sequence:CCGGGCGGCCTTACATCCATATCTACTCGAGTAGATATGGATGTAAGGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024222
VALIDATED
STT3B MISSION shRNA Lentiviral Transduction Particles
STT3B, subunit of the oligosaccharyltransferase complex (catalytic)
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000316744    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024222.2-3126s21c1
Sequence:CCGGGCACCAAAGAACCCTCTAATTCTCGAGAATTAGAGGGTTCTTTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316752    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024222.2-2574s21c1
Sequence:CCGGCGAACACGTAATGCTGAGATTCTCGAGAATCTCAGCATTACGTGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024222.2-889s21c1
Sequence:CCGGGCGGCCTTACATCCATATCTACTCGAGTAGATATGGATGTAAGGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000316742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024222.2-804s21c1
Sequence:CCGGGCTGGCCTTATTCATTGGATTCTCGAGAATCCAATGAATAAGGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093704    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024222.2-3126s1c1
Sequence:CCGGGCACCAAAGAACCCTCTAATTCTCGAGAATTAGAGGGTTCTTTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093706    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024222.2-1896s1c1
Sequence:CCGGGCAGGTAAAGTGAGGAAGCATCTCGAGATGCTTCCTCACTTTACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093708    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024222.2-2574s1c1
Sequence:CCGGCGAACACGTAATGCTGAGATTCTCGAGAATCTCAGCATTACGTGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093707    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024222.2-804s1c1
Sequence:CCGGGCTGGCCTTATTCATTGGATTCTCGAGAATCCAATGAATAAGGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093705    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024222.2-889s1c1
Sequence:CCGGGCGGCCTTACATCCATATCTACTCGAGTAGATATGGATGTAAGGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178862
VALIDATED
STT3B MISSION shRNA Bacterial Glycerol Stock
STT3B, subunit of the oligosaccharyltransferase complex (catalytic)
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000145241    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_178862.1-685s1c1
Sequence:CCGGGCACTTCAGTTCACATACTATCTCGAGATAGTATGTGAACTGAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144463    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178862.1-449s1c1
Sequence:CCGGCTGGCCTTATTCATTGGATTTCTCGAGAAATCCAATGAATAAGGCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144282    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178862.1-885s1c1
Sequence:CCGGCACTTTCTACATTGTGGGTTTCTCGAGAAACCCACAATGTAGAAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_178862.1-2269s1c1
Sequence:CCGGGAAGAAGCCTTTACATCAGAACTCGAGTTCTGATGTAAAGGCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145170    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_178862.1-1990s1c1
Sequence:CCGGGTTATTGGCTATTCTGGTGATCTCGAGATCACCAGAATAGCCAATAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_178862.1-1799s1c1
Sequence:CCGGGAGTAATGTCTTGGTGGGATTCTCGAGAATCCCACCAAGACATTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139592    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178862.1-2056s1c1
Sequence:CCGGCATCCCAAAGACATTCGGGAACTCGAGTTCCCGAATGTCTTTGGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_178862.1-1540s1c1
Sequence:CCGGGCAGGTAAAGTGAGGAAACATCTCGAGATGTTTCCTCACTTTACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_178862.1-2218s1c1
Sequence:CCGGCGAACACGTAATGCTGAGATTCTCGAGAATCTCAGCATTACGTGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139967    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_178862.1-1011s1c1
Sequence:CCGGGCAGTATCTGAGAGACCGATTCTCGAGAATCGGTCTCTCAGATACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_178862.1-1784s1c1
Sequence:CCGGCAGATGAACATGCACGAGTAACTCGAGTTACTCGTGCATGTTCATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142062    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_178862.1-448s1c1
Sequence:CCGGGCTGGCCTTATTCATTGGATTCTCGAGAATCCAATGAATAAGGCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178862
VALIDATED
STT3B MISSION shRNA shRNA Plasmid DNA
STT3B, subunit of the oligosaccharyltransferase complex (catalytic)
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000145241    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_178862.1-685s1c1
Sequence:CCGGGCACTTCAGTTCACATACTATCTCGAGATAGTATGTGAACTGAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144463    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178862.1-449s1c1
Sequence:CCGGCTGGCCTTATTCATTGGATTTCTCGAGAAATCCAATGAATAAGGCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144282    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178862.1-885s1c1
Sequence:CCGGCACTTTCTACATTGTGGGTTTCTCGAGAAACCCACAATGTAGAAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_178862.1-2269s1c1
Sequence:CCGGGAAGAAGCCTTTACATCAGAACTCGAGTTCTGATGTAAAGGCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145170    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_178862.1-1990s1c1
Sequence:CCGGGTTATTGGCTATTCTGGTGATCTCGAGATCACCAGAATAGCCAATAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_178862.1-1799s1c1
Sequence:CCGGGAGTAATGTCTTGGTGGGATTCTCGAGAATCCCACCAAGACATTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139592    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178862.1-2056s1c1
Sequence:CCGGCATCCCAAAGACATTCGGGAACTCGAGTTCCCGAATGTCTTTGGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_178862.1-1540s1c1
Sequence:CCGGGCAGGTAAAGTGAGGAAACATCTCGAGATGTTTCCTCACTTTACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_178862.1-2218s1c1
Sequence:CCGGCGAACACGTAATGCTGAGATTCTCGAGAATCTCAGCATTACGTGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139967    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_178862.1-1011s1c1
Sequence:CCGGGCAGTATCTGAGAGACCGATTCTCGAGAATCGGTCTCTCAGATACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_178862.1-1784s1c1
Sequence:CCGGCAGATGAACATGCACGAGTAACTCGAGTTACTCGTGCATGTTCATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142062    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_178862.1-448s1c1
Sequence:CCGGGCTGGCCTTATTCATTGGATTCTCGAGAATCCAATGAATAAGGCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178862
VALIDATED
STT3B MISSION shRNA Lentiviral Transduction Particles
STT3B, subunit of the oligosaccharyltransferase complex (catalytic)
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000145241    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_178862.1-685s1c1
Sequence:CCGGGCACTTCAGTTCACATACTATCTCGAGATAGTATGTGAACTGAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144463    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178862.1-449s1c1
Sequence:CCGGCTGGCCTTATTCATTGGATTTCTCGAGAAATCCAATGAATAAGGCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144282    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178862.1-885s1c1
Sequence:CCGGCACTTTCTACATTGTGGGTTTCTCGAGAAACCCACAATGTAGAAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_178862.1-2269s1c1
Sequence:CCGGGAAGAAGCCTTTACATCAGAACTCGAGTTCTGATGTAAAGGCTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145170    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_178862.1-1990s1c1
Sequence:CCGGGTTATTGGCTATTCTGGTGATCTCGAGATCACCAGAATAGCCAATAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142443    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_178862.1-1799s1c1
Sequence:CCGGGAGTAATGTCTTGGTGGGATTCTCGAGAATCCCACCAAGACATTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139592    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178862.1-2056s1c1
Sequence:CCGGCATCCCAAAGACATTCGGGAACTCGAGTTCCCGAATGTCTTTGGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_178862.1-1540s1c1
Sequence:CCGGGCAGGTAAAGTGAGGAAACATCTCGAGATGTTTCCTCACTTTACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_178862.1-2218s1c1
Sequence:CCGGCGAACACGTAATGCTGAGATTCTCGAGAATCTCAGCATTACGTGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139967    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_178862.1-1011s1c1
Sequence:CCGGGCAGTATCTGAGAGACCGATTCTCGAGAATCGGTCTCTCAGATACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_178862.1-1784s1c1
Sequence:CCGGCAGATGAACATGCACGAGTAACTCGAGTTACTCGTGCATGTTCATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142062    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_178862.1-448s1c1
Sequence:CCGGGCTGGCCTTATTCATTGGATTCTCGAGAATCCAATGAATAAGGCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks