EMAIL THIS PAGE TO A FRIEND

STUB1

STIP1 homology and U-box containing protein 1, E3 ubiquitin protein ligase

Synonyms: CHIP HSPABP2 NY-CO-7 SDCCAG7 UBOX1
UniProtKB ID: Q9UNE7, A2IDB9, O60526, Q969U2, Q9HBT1
Gene ID:
Human(10273) Summary: STUB1, or CHIP, is a ubiquitin ligase/cochaperone that participates in protein quality control by targeting a broad range of chaperone protein substrates for degradation (Min et al., 2008 [PubMed 18411298]
Mouse(56424) STIP1 homology and U-Box containing protein 1
Rat(287155) STIP1 homology and U-box containing protein 1, E3 ubiquitin protein ligase
Zebrafish(324243) STIP1 homology and U-Box containing protein 1
domestic cat(101092817) STIP1 homology and U-box containing protein 1, E3 ubiquitin protein ligase
dog(479892) STIP1 homology and U-box containing protein 1, E3 ubiquitin protein ligase
chicken(426918) STIP1 homology and U-box containing protein 1, E3 ubiquitin protein ligase
cow(504565) STIP1 homology and U-box containing protein 1, E3 ubiquitin protein ligase
sheep(101103864) STIP1 homology and U-box containing protein 1, E3 ubiquitin protein ligase
naked mole-rat(101703625) STIP1 homology and U-box containing protein 1, E3 ubiquitin protein ligase
domestic guinea pig(100717320) STIP1 homology and U-box containing protein 1, E3 ubiquitin protein ligase
111 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
C9243 Anti-CHIP (C-terminal) antibody produced in rabbit ~1 mg/mL, affinity isolated antibody, buffered aqueous solution mouse, human, rat
western blot pricing
C9118 Anti-CHIP (N-terminal) antibody produced in rabbit ~1 mg/mL, affinity isolated antibody, buffered aqueous solution human, mouse, rat
western blot pricing
SAB1300354 Anti-CHIP (STUB1) (C-term) antibody produced in rabbit saturated ammonium sulfate (SAS) precipitated, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
C5617 Anti-CHIP antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
western blot pricing
SAB2102328 Anti-STUB1 antibody produced in rabbit affinity isolated antibody zebrafish, guinea pig, human, mouse, bovine, rat, horse
western blot pricing
HPA041222 Anti-STUB1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
HPA043531 Anti-STUB1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
SAB2103799 Anti-STUB1, (N-terminal) antibody produced in rabbit affinity isolated antibody , zebrafish, bovine, rat, human, mouse, guinea pig
western blot pricing
SAB2501000 Anti-STUB1/CHIP antibody produced in goat affinity isolated antibody, buffered aqueous solution rat, canine, human, bovine, mouse
ELISA, western blot pricing
SAB1403057 Monoclonal Anti-STUB1, (C-terminal) antibody produced in mouse clone 2E12, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
S1073 Monoclonal Anti-STUB1/CHIP antibody produced in mouse ~1.0 mg/mL, clone ST21.55, purified immunoglobulin, buffered aqueous solution bovine, rat, human
ELISA, western blot pricing
PLA0196 Rabbit anti-STUB1/CHIP Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. mouse, bovine, rhesus monkey, primate, human, rabbit, rabbit, rat, chimpanzee, guinea pig, gorilla, marmoset
immunofluorescence, immunohistochemistry, immunoprecipitation, proximity ligation assay, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019719 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019719 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019719 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005861 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005861 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005861 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005861 Rosetta Predictions human pricing
NM_001025625 Rosetta Predictions rat pricing
NM_019719 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005861 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00183572 predicted 505
2 SASI_Hs01_00183573 predicted 1273
3 SASI_Hs01_00183574 predicted 1272
4 SASI_Hs01_00183575 predicted 823
5 SASI_Hs01_00183576 predicted 748
6 SASI_Hs01_00183577 predicted 1086
7 SASI_Hs01_00183578 predicted 1004
8 SASI_Hs01_00183579 predicted 1108
9 SASI_Hs01_00183580 predicted 1102
10 SASI_Hs01_00183581 predicted 679
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025625 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00203179 predicted 778
2 SASI_Rn01_00039478 predicted 969
3 SASI_Rn01_00039479 predicted 808
4 SASI_Rn02_00203180 predicted 620
5 SASI_Rn02_00203181 predicted 571
6 SASI_Rn01_00039481 predicted 425
7 SASI_Rn01_00039482 predicted 469
8 SASI_Rn02_00203182 predicted 205
9 SASI_Rn01_00039483 predicted 411
10 SASI_Rn02_00203183 predicted 275
11 SASI_Rn01_00039477 predicted 217
12 SASI_Rn01_00039480 predicted 1104
13 SASI_Rn01_00039484 predicted 984
14 SASI_Rn01_00039485 predicted 970
15 SASI_Rn01_00039486 predicted 929
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019719 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00113235 predicted 1181
2 SASI_Mm01_00113237 predicted 1235
3 SASI_Mm01_00113238 predicted 825
4 SASI_Mm01_00113239 predicted 876
5 SASI_Mm01_00113240 predicted 612
6 SASI_Mm02_00324843 predicted 1403
7 SASI_Mm01_00113241 predicted 1370
8 SASI_Mm01_00113242 predicted 1209
9 SASI_Mm01_00113243 predicted 1188
10 SASI_Mm01_00113244 predicted 1049
11 SASI_Mm01_00113236 predicted 988
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019719
VALIDATED
STUB1 MISSION shRNA Bacterial Glycerol Stock
STIP1 homology and U-box containing protein 1, E3 ubiquitin protein ligase
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000008526    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_019719.2-1482s1c1
Sequence:CCGGCCCTGTATAGTTTGTGTCCCTCTCGAGAGGGACACAAACTATACAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008527    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_019719.2-833s1c1
Sequence:CCGGGAGAGTTATGATGAGGCCATTCTCGAGAATGGCCTCATCATAACTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019719.2-983s1c1
Sequence:CCGGGAGAGTGAGCTGCATTCATATCTCGAGATATGAATGCAGCTCACTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008530    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_019719.2-924s1c1
Sequence:CCGGCCCTTCGCATTGCTAAGAAGACTCGAGTCTTCTTAGCAATGCGAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008528    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_019719.2-1121s1c1
Sequence:CCGGCACGATAAATACATGGCAGATCTCGAGATCTGCCATGTATTTATCGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019719.3-833s21c1
Sequence:CCGGGAGAGTTATGATGAGGCCATTCTCGAGAATGGCCTCATCATAACTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019719.3-1121s21c1
Sequence:CCGGCACGATAAATACATGGCAGATCTCGAGATCTGCCATGTATTTATCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019719.3-924s21c1
Sequence:CCGGCCCTTCGCATTGCTAAGAAGACTCGAGTCTTCTTAGCAATGCGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019719.3-983s21c1
Sequence:CCGGGAGAGTGAGCTGCATTCATATCTCGAGATATGAATGCAGCTCACTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019719
VALIDATED
STUB1 MISSION shRNA shRNA Plasmid DNA
STIP1 homology and U-box containing protein 1, E3 ubiquitin protein ligase
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000008526    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_019719.2-1482s1c1
Sequence:CCGGCCCTGTATAGTTTGTGTCCCTCTCGAGAGGGACACAAACTATACAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008527    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_019719.2-833s1c1
Sequence:CCGGGAGAGTTATGATGAGGCCATTCTCGAGAATGGCCTCATCATAACTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019719.2-983s1c1
Sequence:CCGGGAGAGTGAGCTGCATTCATATCTCGAGATATGAATGCAGCTCACTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008530    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_019719.2-924s1c1
Sequence:CCGGCCCTTCGCATTGCTAAGAAGACTCGAGTCTTCTTAGCAATGCGAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008528    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_019719.2-1121s1c1
Sequence:CCGGCACGATAAATACATGGCAGATCTCGAGATCTGCCATGTATTTATCGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019719.3-833s21c1
Sequence:CCGGGAGAGTTATGATGAGGCCATTCTCGAGAATGGCCTCATCATAACTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019719.3-1121s21c1
Sequence:CCGGCACGATAAATACATGGCAGATCTCGAGATCTGCCATGTATTTATCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019719.3-924s21c1
Sequence:CCGGCCCTTCGCATTGCTAAGAAGACTCGAGTCTTCTTAGCAATGCGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019719.3-983s21c1
Sequence:CCGGGAGAGTGAGCTGCATTCATATCTCGAGATATGAATGCAGCTCACTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019719
VALIDATED
STUB1 MISSION shRNA Lentiviral Transduction Particles
STIP1 homology and U-box containing protein 1, E3 ubiquitin protein ligase
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000008526    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_019719.2-1482s1c1
Sequence:CCGGCCCTGTATAGTTTGTGTCCCTCTCGAGAGGGACACAAACTATACAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008527    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_019719.2-833s1c1
Sequence:CCGGGAGAGTTATGATGAGGCCATTCTCGAGAATGGCCTCATCATAACTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008529    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019719.2-983s1c1
Sequence:CCGGGAGAGTGAGCTGCATTCATATCTCGAGATATGAATGCAGCTCACTCTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008530    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_019719.2-924s1c1
Sequence:CCGGCCCTTCGCATTGCTAAGAAGACTCGAGTCTTCTTAGCAATGCGAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008528    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_019719.2-1121s1c1
Sequence:CCGGCACGATAAATACATGGCAGATCTCGAGATCTGCCATGTATTTATCGTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019719.3-833s21c1
Sequence:CCGGGAGAGTTATGATGAGGCCATTCTCGAGAATGGCCTCATCATAACTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280520    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019719.3-1121s21c1
Sequence:CCGGCACGATAAATACATGGCAGATCTCGAGATCTGCCATGTATTTATCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280522    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019719.3-924s21c1
Sequence:CCGGCCCTTCGCATTGCTAAGAAGACTCGAGTCTTCTTAGCAATGCGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280521    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019719.3-983s21c1
Sequence:CCGGGAGAGTGAGCTGCATTCATATCTCGAGATATGAATGCAGCTCACTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005861
VALIDATED
STUB1 MISSION shRNA Bacterial Glycerol Stock
STIP1 homology and U-box containing protein 1, E3 ubiquitin protein ligase
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000007526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_005861.1-716s1c1
Sequence:CCGGGAAGAGGAAGAAGCGAGACATCTCGAGATGTCTCGCTTCTTCCTCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007528    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_005861.1-329s1c1
Sequence:CCGGGCAGTCTGTGAAGGCGCACTTCTCGAGAAGTGCGCCTTCACAGACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_005861.1-479s1c1
Sequence:CCGGCGCGAAGAAGAAGCGCTGGAACTCGAGTTCCAGCGCTTCTTCTTCGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005861.1-927s1c1
Sequence:CCGGGACGCATTCATCTCTGAGAATCTCGAGATTCTCAGAGATGAATGCGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007525    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_005861.1-1069s1c1
Sequence:CCGGCCCAAGTTCTGCTGTTGGACTCTCGAGAGTCCAACAGCAGAACTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005861.2-684s21c1
Sequence:CCGGGCAGTCTGTGAAGGCGCACTTCTCGAGAAGTGCGCCTTCACAGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005861.2-834s21c1
Sequence:CCGGCGCGAAGAAGAAGCGCTGGAACTCGAGTTCCAGCGCTTCTTCTTCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280056    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005861.2-1424s21c1
Sequence:CCGGCCCAAGTTCTGCTGTTGGACTCTCGAGAGTCCAACAGCAGAACTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005861.2-1071s21c1
Sequence:CCGGGAAGAGGAAGAAGCGAGACATCTCGAGATGTCTCGCTTCTTCCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005861
VALIDATED
STUB1 MISSION shRNA shRNA Plasmid DNA
STIP1 homology and U-box containing protein 1, E3 ubiquitin protein ligase
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000007526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_005861.1-716s1c1
Sequence:CCGGGAAGAGGAAGAAGCGAGACATCTCGAGATGTCTCGCTTCTTCCTCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007528    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_005861.1-329s1c1
Sequence:CCGGGCAGTCTGTGAAGGCGCACTTCTCGAGAAGTGCGCCTTCACAGACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_005861.1-479s1c1
Sequence:CCGGCGCGAAGAAGAAGCGCTGGAACTCGAGTTCCAGCGCTTCTTCTTCGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005861.1-927s1c1
Sequence:CCGGGACGCATTCATCTCTGAGAATCTCGAGATTCTCAGAGATGAATGCGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007525    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_005861.1-1069s1c1
Sequence:CCGGCCCAAGTTCTGCTGTTGGACTCTCGAGAGTCCAACAGCAGAACTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005861.2-684s21c1
Sequence:CCGGGCAGTCTGTGAAGGCGCACTTCTCGAGAAGTGCGCCTTCACAGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005861.2-834s21c1
Sequence:CCGGCGCGAAGAAGAAGCGCTGGAACTCGAGTTCCAGCGCTTCTTCTTCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280056    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005861.2-1424s21c1
Sequence:CCGGCCCAAGTTCTGCTGTTGGACTCTCGAGAGTCCAACAGCAGAACTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005861.2-1071s21c1
Sequence:CCGGGAAGAGGAAGAAGCGAGACATCTCGAGATGTCTCGCTTCTTCCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005861
VALIDATED
STUB1 MISSION shRNA Lentiviral Transduction Particles
STIP1 homology and U-box containing protein 1, E3 ubiquitin protein ligase
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000007526    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_005861.1-716s1c1
Sequence:CCGGGAAGAGGAAGAAGCGAGACATCTCGAGATGTCTCGCTTCTTCCTCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007528    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_005861.1-329s1c1
Sequence:CCGGGCAGTCTGTGAAGGCGCACTTCTCGAGAAGTGCGCCTTCACAGACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_005861.1-479s1c1
Sequence:CCGGCGCGAAGAAGAAGCGCTGGAACTCGAGTTCCAGCGCTTCTTCTTCGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005861.1-927s1c1
Sequence:CCGGGACGCATTCATCTCTGAGAATCTCGAGATTCTCAGAGATGAATGCGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007525    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_005861.1-1069s1c1
Sequence:CCGGCCCAAGTTCTGCTGTTGGACTCTCGAGAGTCCAACAGCAGAACTTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352832    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005861.2-684s21c1
Sequence:CCGGGCAGTCTGTGAAGGCGCACTTCTCGAGAAGTGCGCCTTCACAGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005861.2-834s21c1
Sequence:CCGGCGCGAAGAAGAAGCGCTGGAACTCGAGTTCCAGCGCTTCTTCTTCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280056    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005861.2-1424s21c1
Sequence:CCGGCCCAAGTTCTGCTGTTGGACTCTCGAGAGTCCAACAGCAGAACTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005861.2-1071s21c1
Sequence:CCGGGAAGAGGAAGAAGCGAGACATCTCGAGATGTCTCGCTTCTTCCTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks