EMAIL THIS PAGE TO A FRIEND

STX10

syntaxin 10

Synonyms: SYN10 hsyn10
UniProtKB ID: O60499, A6NC41, Q6IAP4, Q96AE8
Gene ID:
Human(8677) Summary: This gene belongs to the syntaxin family and encodes a soluble N-ethylmaleimide sensitive factor attachment protein receptor (SNARE). The encoded protein is involved in docking and fusion events at the Golgi apparatus. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2012]
Zebrafish(492412) syntaxin 10
dog(476691) syntaxin 10
cow(525379) syntaxin 10
sheep(101121171) syntaxin 10
26 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003765 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003765 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003765 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU123871 MISSION® esiRNA esiRNA human STX10 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003765 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003765 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00114687 predicted 302
2 SASI_Hs01_00114688 predicted 320
3 SASI_Hs01_00114689 predicted 493
4 SASI_Hs01_00114690 predicted 357
5 SASI_Hs01_00114692 predicted 477
6 SASI_Hs02_00336254 predicted 424
7 SASI_Hs01_00114693 predicted 467
8 SASI_Hs01_00114694 predicted 515
9 SASI_Hs01_00114695 predicted 201
10 SASI_Hs02_00336255 predicted 510
11 SASI_Hs01_00114686 predicted 466
12 SASI_Hs01_00114691 predicted 464
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003765
VALIDATED
STX10 MISSION shRNA Bacterial Glycerol Stock
syntaxin 10
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000219774    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003765.1-190s1c1
Sequence:CCGGCTGGAAGAGACCATCGGTATACTCGAGTATACCGATGGTCTCTTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_003765.1-322s1c1
Sequence:CCGGAGCCCAACAGCCGTAGCATTTCTCGAGAAATGCTACGGCTGTTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_003765.1-346s1c1
Sequence:CCGGGAGAGGAATAACAGAGAGATACTCGAGTATCTCTCTGTTATTCCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147308    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003765.1-348s1c1
Sequence:CCGGGAGGAATAACAGAGAGATACTCTCGAGAGTATCTCTCTGTTATTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_003765.1-295s1c1
Sequence:CCGGGTCCAGGAAATGAAGGACCATCTCGAGATGGTCCTTCATTTCCTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003765
VALIDATED
STX10 MISSION shRNA shRNA Plasmid DNA
syntaxin 10
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000219774    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003765.1-190s1c1
Sequence:CCGGCTGGAAGAGACCATCGGTATACTCGAGTATACCGATGGTCTCTTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_003765.1-322s1c1
Sequence:CCGGAGCCCAACAGCCGTAGCATTTCTCGAGAAATGCTACGGCTGTTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_003765.1-346s1c1
Sequence:CCGGGAGAGGAATAACAGAGAGATACTCGAGTATCTCTCTGTTATTCCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147308    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003765.1-348s1c1
Sequence:CCGGGAGGAATAACAGAGAGATACTCTCGAGAGTATCTCTCTGTTATTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_003765.1-295s1c1
Sequence:CCGGGTCCAGGAAATGAAGGACCATCTCGAGATGGTCCTTCATTTCCTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003765
VALIDATED
STX10 MISSION shRNA Lentiviral Transduction Particles
syntaxin 10
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000219774    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003765.1-190s1c1
Sequence:CCGGCTGGAAGAGACCATCGGTATACTCGAGTATACCGATGGTCTCTTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219775    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_003765.1-322s1c1
Sequence:CCGGAGCCCAACAGCCGTAGCATTTCTCGAGAAATGCTACGGCTGTTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147779    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_003765.1-346s1c1
Sequence:CCGGGAGAGGAATAACAGAGAGATACTCGAGTATCTCTCTGTTATTCCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147308    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003765.1-348s1c1
Sequence:CCGGGAGGAATAACAGAGAGATACTCTCGAGAGTATCTCTCTGTTATTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_003765.1-295s1c1
Sequence:CCGGGTCCAGGAAATGAAGGACCATCTCGAGATGGTCCTTCATTTCCTGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks