EMAIL THIS PAGE TO A FRIEND

STX11

syntaxin 11

Synonyms: FHL4 HLH4 HPLH4
UniProtKB ID: O75558, E1P598, O75378, O95148, Q5TCL6
Gene ID:
Human(8676) Summary: This gene encodes a member of the syntaxin family. Syntaxins have been implicated in the targeting and fusion of intracellular transport vesicles. This family member may regulate protein transport among late endosomes and the trans-Golgi network. Mutations in this gene have been associated with familial hemophagocytic lymphohistiocytosis. [provided by RefSeq, Jul 2008]
Mouse(74732) syntaxin 11
Rat(292483) syntaxin 11
cow(539960) syntaxin 11
sheep(101119909) syntaxin 11
chicken(428597) syntaxin 11
dog(484019) syntaxin 11
160 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003764 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003764 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003764 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001163591 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001163591 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001163591 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003764 Rosetta Predictions human pricing
NM_001025638 Rosetta Predictions rat pricing
XM_001472888 Rosetta Predictions mouse pricing
XM_001473721 Rosetta Predictions mouse pricing
XM_203312 Rosetta Predictions mouse pricing
XM_886256 Rosetta Predictions mouse pricing
XM_896683 Rosetta Predictions mouse pricing
XM_896707 Rosetta Predictions mouse pricing
XM_920202 Rosetta Predictions mouse pricing
XM_920212 Rosetta Predictions mouse pricing
XM_920225 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003764 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00127588 predicted 562
2 SASI_Hs01_00127590 predicted 1257
3 SASI_Hs01_00127591 predicted 1305
4 SASI_Hs01_00127592 predicted 717
5 SASI_Hs01_00127593 predicted 319
6 SASI_Hs01_00127594 predicted 638
7 SASI_Hs01_00127596 predicted 1349
8 SASI_Hs01_00127597 predicted 1270
9 SASI_Hs02_00336252 predicted 1412
10 SASI_Hs02_00336253 predicted 1391
11 SASI_Hs01_00127589 predicted 424
12 SASI_Hs01_00127595 predicted 1420
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025638 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00055879 predicted 1022
2 SASI_Rn01_00055880 predicted 629
3 SASI_Rn01_00055881 predicted 915
4 SASI_Rn01_00055882 predicted 920
5 SASI_Rn01_00055883 predicted 304
6 SASI_Rn01_00055884 predicted 624
7 SASI_Rn01_00055885 predicted 775
8 SASI_Rn01_00055886 predicted 1068
9 SASI_Rn01_00055887 predicted 880
10 SASI_Rn01_00055888 predicted 785
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001472888 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00364476 predicted 675
2 SASI_Mm02_00364477 predicted 730
3 SASI_Mm02_00364478 predicted 681
4 SASI_Mm02_00364479 predicted 579
5 SASI_Mm02_00364480 predicted 616
6 SASI_Mm02_00364481 predicted 574
7 SASI_Mm02_00364482 predicted 726
8 SASI_Mm02_00364483 predicted 599
9 SASI_Mm02_00364484 predicted 680
10 SASI_Mm02_00364485 predicted 595
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001473721 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00370218 predicted 1203
2 SASI_Mm02_00370219 predicted 1483
3 SASI_Mm02_00370220 predicted 1439
4 SASI_Mm02_00370221 predicted 1502
5 SASI_Mm02_00370222 predicted 1200
6 SASI_Mm02_00370223 predicted 1365
7 SASI_Mm02_00370224 predicted 1348
8 SASI_Mm02_00370225 predicted 1203
9 SASI_Mm02_00370226 predicted 614
10 SASI_Mm02_00370227 predicted 1228
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_203312 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00226674 predicted 904
2 SASI_Mm02_00425502 predicted 970
3 SASI_Mm02_00425503 predicted 914
4 SASI_Mm02_00425504 predicted 809
5 SASI_Mm02_00425505 predicted 843
6 SASI_Mm02_00425506 predicted 804
7 SASI_Mm02_00425507 predicted 957
8 SASI_Mm02_00425508 predicted 839
9 SASI_Mm02_00425509 predicted 911
10 SASI_Mm02_00425510 predicted 821
11 SASI_Mm01_00226670 predicted 1446
12 SASI_Mm01_00226671 predicted 1721
13 SASI_Mm01_00226672 predicted 1679
14 SASI_Mm01_00226673 predicted 1751
15 SASI_Mm01_00226675 predicted 1742
16 SASI_Mm01_00226676 predicted 1441
17 SASI_Mm01_00226677 predicted 1607
18 SASI_Mm01_00226678 predicted 1592
19 SASI_Mm01_00226679 predicted 1432
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_886256 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00278373 predicted 1362
2 SASI_Mm01_00278374 predicted 1641
3 SASI_Mm01_00278375 predicted 1605
4 SASI_Mm01_00278376 predicted 1672
5 SASI_Mm01_00278377 predicted 832
6 SASI_Mm01_00278378 predicted 1660
7 SASI_Mm01_00278379 predicted 1358
8 SASI_Mm01_00278380 predicted 1526
9 SASI_Mm01_00278381 predicted 1505
10 SASI_Mm01_00278382 predicted 1356
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_896683 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00241243 predicted 768
2 SASI_Mm02_00429765 predicted 830
3 SASI_Mm02_00429766 predicted 774
4 SASI_Mm02_00429767 predicted 673
5 SASI_Mm02_00429768 predicted 703
6 SASI_Mm02_00429769 predicted 673
7 SASI_Mm02_00429770 predicted 816
8 SASI_Mm02_00429771 predicted 698
9 SASI_Mm02_00429772 predicted 765
10 SASI_Mm02_00429773 predicted 688
11 SASI_Mm01_00241239 predicted 1311
12 SASI_Mm01_00241240 predicted 1589
13 SASI_Mm01_00241241 predicted 1540
14 SASI_Mm01_00241242 predicted 1612
15 SASI_Mm01_00241244 predicted 1601
16 SASI_Mm01_00241245 predicted 1293
17 SASI_Mm01_00241246 predicted 1464
18 SASI_Mm01_00241247 predicted 1455
19 SASI_Mm01_00241248 predicted 1302
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_896707 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00210672 predicted 848
2 SASI_Mm02_00429774 predicted 903
3 SASI_Mm02_00429775 predicted 847
4 SASI_Mm02_00429776 predicted 750
5 SASI_Mm02_00429777 predicted 783
6 SASI_Mm02_00429778 predicted 749
7 SASI_Mm02_00429779 predicted 898
8 SASI_Mm02_00429780 predicted 777
9 SASI_Mm02_00429781 predicted 849
10 SASI_Mm02_00429782 predicted 763
11 SASI_Mm01_00210668 predicted 1389
12 SASI_Mm01_00210669 predicted 1661
13 SASI_Mm01_00210670 predicted 1618
14 SASI_Mm01_00210671 predicted 1697
15 SASI_Mm01_00210673 predicted 1683
16 SASI_Mm01_00210674 predicted 1377
17 SASI_Mm01_00210675 predicted 1546
18 SASI_Mm01_00210676 predicted 1532
19 SASI_Mm01_00210677 predicted 1382
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_920202 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00442502 predicted 1297
2 SASI_Mm02_00442503 predicted 1585
3 SASI_Mm02_00442504 predicted 1539
4 SASI_Mm02_00442505 predicted 1596
5 SASI_Mm02_00442506 predicted 1292
6 SASI_Mm02_00442507 predicted 1459
7 SASI_Mm02_00442508 predicted 1448
8 SASI_Mm02_00442509 predicted 1293
9 SASI_Mm02_00442510 predicted 704
10 SASI_Mm02_00442511 predicted 1320
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_920212 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00442512 predicted 1437
2 SASI_Mm02_00442513 predicted 1721
3 SASI_Mm02_00442514 predicted 1675
4 SASI_Mm02_00442515 predicted 1735
5 SASI_Mm02_00442516 predicted 1428
6 SASI_Mm02_00442517 predicted 1601
7 SASI_Mm02_00442518 predicted 1583
8 SASI_Mm02_00442519 predicted 1432
9 SASI_Mm02_00442520 predicted 845
10 SASI_Mm02_00442521 predicted 1459
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_920225 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00442537 predicted 1378
2 SASI_Mm02_00442538 predicted 1659
3 SASI_Mm02_00442539 predicted 1617
4 SASI_Mm02_00442540 predicted 1668
5 SASI_Mm02_00442541 predicted 1375
6 SASI_Mm02_00442542 predicted 1533
7 SASI_Mm02_00442543 predicted 1524
8 SASI_Mm02_00442544 predicted 1372
9 SASI_Mm02_00442545 predicted 784
10 SASI_Mm02_00442546 predicted 1406
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003764
STX11 MISSION shRNA Bacterial Glycerol Stock
syntaxin 11
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000065076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003764.2-907s1c1
Sequence:CCGGGTCATCGAGCTCAACGTACAACTCGAGTTGTACGTTGAGCTCGATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003764.2-429s1c1
Sequence:CCGGCGACACCAACTCCATCGCCAACTCGAGTTGGCGATGGAGTTGGTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003764.2-276s1c1
Sequence:CCGGCGTGTTCGAGACGGACCACATCTCGAGATGTGGTCCGTCTCGAACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003764.2-633s1c1
Sequence:CCGGGCAGCGCGACAACTGCAAGATCTCGAGATCTTGCAGTTGTCGCGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003764.2-723s1c1
Sequence:CCGGGCAGGGTAAGTGGGACGTGTTCTCGAGAACACGTCCCACTTACCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381978    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003764.3-454s21c1
Sequence:GTACCGGTCCATCGCCAAGGCCATCAAGCTCGAGCTTGATGGCCTTGGCGATGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003764.3-335s21c1
Sequence:GTACCGGTCCGGGACATTCAGGATGAAACTCGAGTTTCATCCTGAATGTCCCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003764.3-641s21c1
Sequence:GTACCGGAGATGAAGCAGCGCGACAACTCTCGAGAGTTGTCGCGCTGCTTCATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003764.3-923s21c1
Sequence:GTACCGGTCATCGAGCTCAACGTACAAACTCGAGTTTGTACGTTGAGCTCGATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003764.3-686s21c1
Sequence:GTACCGGTGGAGATCATGGGCAAGGAAGCTCGAGCTTCCTTGCCCATGATCTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379834    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003764.3-1236s21c1
Sequence:GTACCGGGTTGATACCGTCCGATGATTCCTCGAGGAATCATCGGACGGTATCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003764.3-764s21c1
Sequence:GTACCGGAGAACTTGCTGGCCGACGTGACTCGAGTCACGTCGGCCAGCAAGTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381070    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003764.3-290s21c1
Sequence:GTACCGGTCGTGTTCGAGACGGACCACACTCGAGTGTGGTCCGTCTCGAACACGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381296    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003764.3-230s21c1
Sequence:GTACCGGAGCAATATGACCAGCAGTTCCCTCGAGGGAACTGCTGGTCATATTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003764
STX11 MISSION shRNA shRNA Plasmid DNA
syntaxin 11
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000065076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003764.2-907s1c1
Sequence:CCGGGTCATCGAGCTCAACGTACAACTCGAGTTGTACGTTGAGCTCGATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003764.2-429s1c1
Sequence:CCGGCGACACCAACTCCATCGCCAACTCGAGTTGGCGATGGAGTTGGTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003764.2-276s1c1
Sequence:CCGGCGTGTTCGAGACGGACCACATCTCGAGATGTGGTCCGTCTCGAACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003764.2-633s1c1
Sequence:CCGGGCAGCGCGACAACTGCAAGATCTCGAGATCTTGCAGTTGTCGCGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003764.2-723s1c1
Sequence:CCGGGCAGGGTAAGTGGGACGTGTTCTCGAGAACACGTCCCACTTACCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381978    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003764.3-454s21c1
Sequence:GTACCGGTCCATCGCCAAGGCCATCAAGCTCGAGCTTGATGGCCTTGGCGATGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003764.3-335s21c1
Sequence:GTACCGGTCCGGGACATTCAGGATGAAACTCGAGTTTCATCCTGAATGTCCCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003764.3-641s21c1
Sequence:GTACCGGAGATGAAGCAGCGCGACAACTCTCGAGAGTTGTCGCGCTGCTTCATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003764.3-923s21c1
Sequence:GTACCGGTCATCGAGCTCAACGTACAAACTCGAGTTTGTACGTTGAGCTCGATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003764.3-686s21c1
Sequence:GTACCGGTGGAGATCATGGGCAAGGAAGCTCGAGCTTCCTTGCCCATGATCTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379834    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003764.3-1236s21c1
Sequence:GTACCGGGTTGATACCGTCCGATGATTCCTCGAGGAATCATCGGACGGTATCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003764.3-764s21c1
Sequence:GTACCGGAGAACTTGCTGGCCGACGTGACTCGAGTCACGTCGGCCAGCAAGTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381070    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003764.3-290s21c1
Sequence:GTACCGGTCGTGTTCGAGACGGACCACACTCGAGTGTGGTCCGTCTCGAACACGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381296    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003764.3-230s21c1
Sequence:GTACCGGAGCAATATGACCAGCAGTTCCCTCGAGGGAACTGCTGGTCATATTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003764
STX11 MISSION shRNA Lentiviral Transduction Particles
syntaxin 11
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000065076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003764.2-907s1c1
Sequence:CCGGGTCATCGAGCTCAACGTACAACTCGAGTTGTACGTTGAGCTCGATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003764.2-429s1c1
Sequence:CCGGCGACACCAACTCCATCGCCAACTCGAGTTGGCGATGGAGTTGGTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065074    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003764.2-276s1c1
Sequence:CCGGCGTGTTCGAGACGGACCACATCTCGAGATGTGGTCCGTCTCGAACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003764.2-633s1c1
Sequence:CCGGGCAGCGCGACAACTGCAAGATCTCGAGATCTTGCAGTTGTCGCGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065073    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003764.2-723s1c1
Sequence:CCGGGCAGGGTAAGTGGGACGTGTTCTCGAGAACACGTCCCACTTACCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381978    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003764.3-454s21c1
Sequence:GTACCGGTCCATCGCCAAGGCCATCAAGCTCGAGCTTGATGGCCTTGGCGATGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003764.3-335s21c1
Sequence:GTACCGGTCCGGGACATTCAGGATGAAACTCGAGTTTCATCCTGAATGTCCCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003764.3-641s21c1
Sequence:GTACCGGAGATGAAGCAGCGCGACAACTCTCGAGAGTTGTCGCGCTGCTTCATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381546    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003764.3-923s21c1
Sequence:GTACCGGTCATCGAGCTCAACGTACAAACTCGAGTTTGTACGTTGAGCTCGATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379423    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003764.3-686s21c1
Sequence:GTACCGGTGGAGATCATGGGCAAGGAAGCTCGAGCTTCCTTGCCCATGATCTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379834    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003764.3-1236s21c1
Sequence:GTACCGGGTTGATACCGTCCGATGATTCCTCGAGGAATCATCGGACGGTATCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380661    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003764.3-764s21c1
Sequence:GTACCGGAGAACTTGCTGGCCGACGTGACTCGAGTCACGTCGGCCAGCAAGTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381070    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003764.3-290s21c1
Sequence:GTACCGGTCGTGTTCGAGACGGACCACACTCGAGTGTGGTCCGTCTCGAACACGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381296    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003764.3-230s21c1
Sequence:GTACCGGAGCAATATGACCAGCAGTTCCCTCGAGGGAACTGCTGGTCATATTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001163591
STX11 MISSION shRNA Bacterial Glycerol Stock
syntaxin 11
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000341533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163591.1-895s21c1
Sequence:CCGGGTGCAGAAGACCCTCGATTACCTCGAGGTAATCGAGGGTCTTCTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163591.1-696s21c1
Sequence:CCGGGCAGGGCAAGTGGGATGTATTCTCGAGAATACATCCCACTTGCCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341531    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001163591.1-1350s21c1
Sequence:CCGGGCTAATAGTATGAGTACATTACTCGAGTAATGTACTCATACTATTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341604    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163591.1-873s21c1
Sequence:CCGGGCTGAACGTCATCGAGCTTAACTCGAGTTAAGCTCGATGACGTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163591.1-178s21c1
Sequence:CCGGGAATTGTCCAGGAGCTATGACCTCGAGGTCATAGCTCCTGGACAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001163591
STX11 MISSION shRNA shRNA Plasmid DNA
syntaxin 11
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000341533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163591.1-895s21c1
Sequence:CCGGGTGCAGAAGACCCTCGATTACCTCGAGGTAATCGAGGGTCTTCTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163591.1-696s21c1
Sequence:CCGGGCAGGGCAAGTGGGATGTATTCTCGAGAATACATCCCACTTGCCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341531    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001163591.1-1350s21c1
Sequence:CCGGGCTAATAGTATGAGTACATTACTCGAGTAATGTACTCATACTATTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341604    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163591.1-873s21c1
Sequence:CCGGGCTGAACGTCATCGAGCTTAACTCGAGTTAAGCTCGATGACGTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163591.1-178s21c1
Sequence:CCGGGAATTGTCCAGGAGCTATGACCTCGAGGTCATAGCTCCTGGACAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001163591
STX11 MISSION shRNA Lentiviral Transduction Particles
syntaxin 11
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000341533    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163591.1-895s21c1
Sequence:CCGGGTGCAGAAGACCCTCGATTACCTCGAGGTAATCGAGGGTCTTCTGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341532    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163591.1-696s21c1
Sequence:CCGGGCAGGGCAAGTGGGATGTATTCTCGAGAATACATCCCACTTGCCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341531    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001163591.1-1350s21c1
Sequence:CCGGGCTAATAGTATGAGTACATTACTCGAGTAATGTACTCATACTATTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341604    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163591.1-873s21c1
Sequence:CCGGGCTGAACGTCATCGAGCTTAACTCGAGTTAAGCTCGATGACGTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001163591.1-178s21c1
Sequence:CCGGGAATTGTCCAGGAGCTATGACCTCGAGGTCATAGCTCCTGGACAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks