EMAIL THIS PAGE TO A FRIEND

STX12

syntaxin 12

Synonyms: STX13 STX14
UniProtKB ID: Q86Y82, B1AJQ7, O95564
Gene ID:
Mouse(100226) syntaxin 12
Rat(65033) syntaxin 12
Zebrafish(415141) syntaxin 12
chicken(769300) syntaxin 12
dog(478168) syntaxin 12
cow(505538) syntaxin 12
sheep(101112461) syntaxin 12
201 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_177424 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_177424 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_177424 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_133887 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133887 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133887 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_177424 Rosetta Predictions human pricing
NM_022939 Rosetta Predictions rat pricing
NM_133887 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177424 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00036156 predicted 323
2 SASI_Hs01_00036157 predicted 309
3 SASI_Hs01_00036158 predicted 421
4 SASI_Hs02_00369324 predicted 1034
5 SASI_Hs01_00036160 predicted 756
6 SASI_Hs02_00369325 predicted 907
7 SASI_Hs02_00369326 predicted 949
8 SASI_Hs02_00369327 predicted 1026
9 SASI_Hs01_00036162 predicted 823
10 SASI_Hs02_00369328 predicted 919
11 SASI_Hs01_00036159 predicted 263
12 SASI_Hs01_00036161 predicted 580
13 SASI_Hs01_00036163 predicted 1361
14 SASI_Hs01_00036164 predicted 666
15 SASI_Hs01_00036165 predicted 754
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022939 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00263653 predicted 661
2 SASI_Rn01_00112003 predicted 708
3 SASI_Rn01_00112005 predicted 991
4 SASI_Rn01_00112006 predicted 283
5 SASI_Rn01_00112007 predicted 853
6 SASI_Rn02_00263654 predicted 847
7 SASI_Rn01_00112008 predicted 816
8 SASI_Rn01_00112009 predicted 688
9 SASI_Rn02_00263655 predicted 871
10 SASI_Rn01_00112010 predicted 295
11 SASI_Rn01_00112001 predicted 436
12 SASI_Rn01_00112002 predicted 863
13 SASI_Rn01_00112004 predicted 878
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133887 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00158219 predicted 878
2 SASI_Mm01_00158220 predicted 444
3 SASI_Mm01_00158221 predicted 729
4 SASI_Mm01_00158222 predicted 554
5 SASI_Mm01_00158223 predicted 787
6 SASI_Mm01_00158224 predicted 888
7 SASI_Mm01_00158225 predicted 296
8 SASI_Mm01_00158226 predicted 702
9 SASI_Mm01_00158227 predicted 865
10 SASI_Mm01_00158228 predicted 1007
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177424
VALIDATED
STX12 MISSION shRNA Bacterial Glycerol Stock
syntaxin 12
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000382482    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_177424.2-1267s21c1
Sequence:GTACCGGGACACTACAGTCTCGTAATATCTCGAGATATTACGAGACTGTAGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_177424.2-344s21c1
Sequence:CCGGCGCCAAGGAAACAAATGAATTCTCGAGAATTCATTTGTTTCCTTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_177424.2-890s21c1
Sequence:CCGGGCTTGTCCTGTCAGTGATTATCTCGAGATAATCACTGACAGGACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_177424.2-840s21c1
Sequence:CCGGCGAGCTGCTTACTATCAGAAACTCGAGTTTCTGATAGTAAGCAGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_177424.2-240s21c1
Sequence:CCGGGCCACTGCTCAGATAAAGAATCTCGAGATTCTTTATCTGAGCAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_177424.1-818s1c1
Sequence:CCGGGCTTGTCCTGTCAGTGATTATCTCGAGATAATCACTGACAGGACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065048    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_177424.1-768s1c1
Sequence:CCGGCGAGCTGCTTACTATCAGAAACTCGAGTTTCTGATAGTAAGCAGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_177424.1-168s1c1
Sequence:CCGGGCCACTGCTCAGATAAAGAATCTCGAGATTCTTTATCTGAGCAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065050    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A3
TRC Version: 1 Clone ID:NM_177424.1-578s1c1
Sequence:CCGGGCAGGATTTGGAACTTATTAACTCGAGTTAATAAGTTCCAAATCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065049    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_177424.1-272s1c1
Sequence:CCGGCGCCAAGGAAACAAATGAATTCTCGAGAATTCATTTGTTTCCTTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177424
VALIDATED
STX12 MISSION shRNA shRNA Plasmid DNA
syntaxin 12
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000382482    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_177424.2-1267s21c1
Sequence:GTACCGGGACACTACAGTCTCGTAATATCTCGAGATATTACGAGACTGTAGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_177424.2-344s21c1
Sequence:CCGGCGCCAAGGAAACAAATGAATTCTCGAGAATTCATTTGTTTCCTTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_177424.2-890s21c1
Sequence:CCGGGCTTGTCCTGTCAGTGATTATCTCGAGATAATCACTGACAGGACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_177424.2-840s21c1
Sequence:CCGGCGAGCTGCTTACTATCAGAAACTCGAGTTTCTGATAGTAAGCAGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_177424.2-240s21c1
Sequence:CCGGGCCACTGCTCAGATAAAGAATCTCGAGATTCTTTATCTGAGCAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_177424.1-818s1c1
Sequence:CCGGGCTTGTCCTGTCAGTGATTATCTCGAGATAATCACTGACAGGACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065048    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_177424.1-768s1c1
Sequence:CCGGCGAGCTGCTTACTATCAGAAACTCGAGTTTCTGATAGTAAGCAGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_177424.1-168s1c1
Sequence:CCGGGCCACTGCTCAGATAAAGAATCTCGAGATTCTTTATCTGAGCAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065050    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A3
TRC Version: 1 Clone ID:NM_177424.1-578s1c1
Sequence:CCGGGCAGGATTTGGAACTTATTAACTCGAGTTAATAAGTTCCAAATCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065049    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_177424.1-272s1c1
Sequence:CCGGCGCCAAGGAAACAAATGAATTCTCGAGAATTCATTTGTTTCCTTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177424
VALIDATED
STX12 MISSION shRNA Lentiviral Transduction Particles
syntaxin 12
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000382482    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_177424.2-1267s21c1
Sequence:GTACCGGGACACTACAGTCTCGTAATATCTCGAGATATTACGAGACTGTAGTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_177424.2-344s21c1
Sequence:CCGGCGCCAAGGAAACAAATGAATTCTCGAGAATTCATTTGTTTCCTTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333599    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_177424.2-890s21c1
Sequence:CCGGGCTTGTCCTGTCAGTGATTATCTCGAGATAATCACTGACAGGACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333598    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_177424.2-840s21c1
Sequence:CCGGCGAGCTGCTTACTATCAGAAACTCGAGTTTCTGATAGTAAGCAGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_177424.2-240s21c1
Sequence:CCGGGCCACTGCTCAGATAAAGAATCTCGAGATTCTTTATCTGAGCAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_177424.1-818s1c1
Sequence:CCGGGCTTGTCCTGTCAGTGATTATCTCGAGATAATCACTGACAGGACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065048    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_177424.1-768s1c1
Sequence:CCGGCGAGCTGCTTACTATCAGAAACTCGAGTTTCTGATAGTAAGCAGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_177424.1-168s1c1
Sequence:CCGGGCCACTGCTCAGATAAAGAATCTCGAGATTCTTTATCTGAGCAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065050    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A3
TRC Version: 1 Clone ID:NM_177424.1-578s1c1
Sequence:CCGGGCAGGATTTGGAACTTATTAACTCGAGTTAATAAGTTCCAAATCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065049    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_177424.1-272s1c1
Sequence:CCGGCGCCAAGGAAACAAATGAATTCTCGAGAATTCATTTGTTTCCTTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133887
VALIDATED
STX12 MISSION shRNA Bacterial Glycerol Stock
syntaxin 12
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000376931    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133887.4-1037s21c1
Sequence:CCGGAGCTAGAATCTAACTACTAACCTCGAGGTTAGTAGTTAGATTCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133887.4-867s21c1
Sequence:CCGGGTCAGTGATTGTTACAGTCTTCTCGAGAAGACTGTAACAATCACTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133887.4-709s21c1
Sequence:CCGGGCTATGATGATCCATGACCAACTCGAGTTGGTCATGGATCATCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133887.4-801s21c1
Sequence:CCGGGCTACAAAGAGCTGCTTACTACTCGAGTAGTAAGCAGCTCTTTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319429    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133887.4-1201s21c1
Sequence:CCGGGACAGTTCCATCGTGGATATTCTCGAGAATATCCACGATGGAACTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133887.4-563s21c1
Sequence:CCGGGCCATGAAGAGTGGAACCAAACTCGAGTTTGGTTCCACTCTTCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_133887.2-564s1c1
Sequence:CCGGGCCATGAAGAGTGGAACCAAACTCGAGTTTGGTTCCACTCTTCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100930    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133887.2-1818s1c1
Sequence:CCGGCCTGGCTTTGATGGCAAGATTCTCGAGAATCTTGCCATCAAAGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_133887.2-710s1c1
Sequence:CCGGGCTATGATGATCCATGACCAACTCGAGTTGGTCATGGATCATCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_133887.2-868s1c1
Sequence:CCGGGTCAGTGATTGTTACAGTCTTCTCGAGAAGACTGTAACAATCACTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_133887.2-802s1c1
Sequence:CCGGGCTACAAAGAGCTGCTTACTACTCGAGTAGTAAGCAGCTCTTTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133887
VALIDATED
STX12 MISSION shRNA shRNA Plasmid DNA
syntaxin 12
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000376931    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133887.4-1037s21c1
Sequence:CCGGAGCTAGAATCTAACTACTAACCTCGAGGTTAGTAGTTAGATTCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133887.4-867s21c1
Sequence:CCGGGTCAGTGATTGTTACAGTCTTCTCGAGAAGACTGTAACAATCACTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133887.4-709s21c1
Sequence:CCGGGCTATGATGATCCATGACCAACTCGAGTTGGTCATGGATCATCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133887.4-801s21c1
Sequence:CCGGGCTACAAAGAGCTGCTTACTACTCGAGTAGTAAGCAGCTCTTTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319429    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133887.4-1201s21c1
Sequence:CCGGGACAGTTCCATCGTGGATATTCTCGAGAATATCCACGATGGAACTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133887.4-563s21c1
Sequence:CCGGGCCATGAAGAGTGGAACCAAACTCGAGTTTGGTTCCACTCTTCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_133887.2-564s1c1
Sequence:CCGGGCCATGAAGAGTGGAACCAAACTCGAGTTTGGTTCCACTCTTCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100930    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133887.2-1818s1c1
Sequence:CCGGCCTGGCTTTGATGGCAAGATTCTCGAGAATCTTGCCATCAAAGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_133887.2-710s1c1
Sequence:CCGGGCTATGATGATCCATGACCAACTCGAGTTGGTCATGGATCATCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_133887.2-868s1c1
Sequence:CCGGGTCAGTGATTGTTACAGTCTTCTCGAGAAGACTGTAACAATCACTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_133887.2-802s1c1
Sequence:CCGGGCTACAAAGAGCTGCTTACTACTCGAGTAGTAAGCAGCTCTTTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133887
VALIDATED
STX12 MISSION shRNA Lentiviral Transduction Particles
syntaxin 12
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000376931    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133887.4-1037s21c1
Sequence:CCGGAGCTAGAATCTAACTACTAACCTCGAGGTTAGTAGTTAGATTCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317617    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133887.4-867s21c1
Sequence:CCGGGTCAGTGATTGTTACAGTCTTCTCGAGAAGACTGTAACAATCACTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317542    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133887.4-709s21c1
Sequence:CCGGGCTATGATGATCCATGACCAACTCGAGTTGGTCATGGATCATCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317616    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133887.4-801s21c1
Sequence:CCGGGCTACAAAGAGCTGCTTACTACTCGAGTAGTAAGCAGCTCTTTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319429    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_133887.4-1201s21c1
Sequence:CCGGGACAGTTCCATCGTGGATATTCTCGAGAATATCCACGATGGAACTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133887.4-563s21c1
Sequence:CCGGGCCATGAAGAGTGGAACCAAACTCGAGTTTGGTTCCACTCTTCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_133887.2-564s1c1
Sequence:CCGGGCCATGAAGAGTGGAACCAAACTCGAGTTTGGTTCCACTCTTCATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100930    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133887.2-1818s1c1
Sequence:CCGGCCTGGCTTTGATGGCAAGATTCTCGAGAATCTTGCCATCAAAGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100931    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_133887.2-710s1c1
Sequence:CCGGGCTATGATGATCCATGACCAACTCGAGTTGGTCATGGATCATCATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_133887.2-868s1c1
Sequence:CCGGGTCAGTGATTGTTACAGTCTTCTCGAGAAGACTGTAACAATCACTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100932    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_133887.2-802s1c1
Sequence:CCGGGCTACAAAGAGCTGCTTACTACTCGAGTAGTAAGCAGCTCTTTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks