EMAIL THIS PAGE TO A FRIEND

STX16

syntaxin 16

Synonyms: SYN16
Gene ID:
Human(8675) Summary: This gene encodes a protein that is a member of the syntaxin or t-SNARE (target-SNAP receptor) family. These proteins are found on cell membranes and serve as the targets for V-SNARES (vesicle-SNAP receptors) permitting specific synaptic vesicle docking and fusion. A microdeletion in the region of chromosome 20 where this gene is located has been associated with pseudohypoparathyroidism type Ib. Multiple transcript variants have been found for this gene. Read-through transcription also exists between this gene and the neighboring downstream aminopeptidase-like 1 (NPEPL1) gene. [provided by RefSeq, Mar 2011]
Mouse(228960) syntaxin 16
Rat(362283) syntaxin 16
Zebrafish(562857) syntaxin 16
dog(477275) syntaxin 16
chicken(419315) syntaxin 16
cow(519624) syntaxin 16
sheep(101116075) syntaxin 16
254 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172675 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172675 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172675 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003763 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003763 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003763 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001001433 Rosetta Predictions human pricing
NM_003763 Rosetta Predictions human pricing
NM_001108610 Rosetta Predictions rat pricing
NM_001102423 Rosetta Predictions mouse pricing
NM_001102424 Rosetta Predictions mouse pricing
NM_001102425 Rosetta Predictions mouse pricing
NM_172675 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001433 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00141508 predicted 1083
2 SASI_Hs01_00141509 predicted 1446
3 SASI_Hs01_00141510 predicted 1541
4 SASI_Hs01_00141511 predicted 1350
5 SASI_Hs01_00141512 predicted 1454
6 SASI_Hs01_00141513 predicted 1704
7 SASI_Hs01_00141514 predicted 1526
8 SASI_Hs01_00141515 predicted 1082
9 SASI_Hs02_00303773 predicted 1284
10 SASI_Hs01_00141516 predicted 1534
11 SASI_Hs01_00141517 predicted 1604
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003763 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00195663 predicted 1021
2 SASI_Hs01_00195664 predicted 1377
3 SASI_Hs01_00195665 predicted 1478
4 SASI_Hs01_00195666 predicted 1286
5 SASI_Hs01_00195667 predicted 1392
6 SASI_Hs01_00195668 predicted 1644
7 SASI_Hs01_00195669 predicted 1456
8 SASI_Hs01_00195670 predicted 1011
9 SASI_Hs02_00336251 predicted 1225
10 SASI_Hs01_00195671 predicted 1469
11 SASI_Hs01_00195672 predicted 1541
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108610 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00240329 predicted 569
2 SASI_Rn02_00240330 predicted 727
3 SASI_Rn02_00240331 predicted 452
4 SASI_Rn02_00240332 predicted 1256
5 SASI_Rn02_00240333 predicted 671
6 SASI_Rn02_00240334 predicted 399
7 SASI_Rn02_00240335 predicted 551
8 SASI_Rn02_00240336 predicted 653
9 SASI_Rn02_00240337 predicted 626
10 SASI_Rn02_00240338 predicted 462
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001102423 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00302773 predicted 995
2 SASI_Mm02_00302774 predicted 783
3 SASI_Mm02_00302775 predicted 789
4 SASI_Mm02_00302776 predicted 721
5 SASI_Mm02_00302777 predicted 543
6 SASI_Mm02_00302778 predicted 958
7 SASI_Mm02_00302779 predicted 999
8 SASI_Mm02_00302780 predicted 837
9 SASI_Mm02_00302781 predicted 892
10 SASI_Mm02_00302782 predicted 999
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001102424 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00302783 predicted 960
2 SASI_Mm02_00302784 predicted 744
3 SASI_Mm02_00302785 predicted 748
4 SASI_Mm02_00302786 predicted 681
5 SASI_Mm02_00302787 predicted 496
6 SASI_Mm02_00302788 predicted 916
7 SASI_Mm02_00302789 predicted 965
8 SASI_Mm02_00302790 predicted 799
9 SASI_Mm02_00302791 predicted 848
10 SASI_Mm02_00302792 predicted 964
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001102425 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00302793 predicted 941
2 SASI_Mm02_00302794 predicted 735
3 SASI_Mm02_00302795 predicted 737
4 SASI_Mm02_00302796 predicted 661
5 SASI_Mm02_00302797 predicted 489
6 SASI_Mm02_00302798 predicted 904
7 SASI_Mm02_00302799 predicted 951
8 SASI_Mm02_00302800 predicted 787
9 SASI_Mm02_00302801 predicted 837
10 SASI_Mm02_00302802 predicted 945
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172675 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00111354 predicted 1004
2 SASI_Mm01_00111355 predicted 795
3 SASI_Mm02_00344414 predicted 801
4 SASI_Mm01_00111356 predicted 733
5 SASI_Mm01_00111358 predicted 555
6 SASI_Mm01_00111359 predicted 961
7 SASI_Mm01_00111362 predicted 1018
8 SASI_Mm02_00344415 predicted 853
9 SASI_Mm02_00344416 predicted 906
10 SASI_Mm02_00344417 predicted 1011
11 SASI_Mm01_00111353 predicted 569
12 SASI_Mm01_00111357 predicted 293
13 SASI_Mm01_00111360 predicted 286
14 SASI_Mm01_00111361 predicted 1021
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172675
VALIDATED
STX16 MISSION shRNA Bacterial Glycerol Stock
syntaxin 16
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000089313    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172675.1-1812s1c1
Sequence:CCGGCCGTTTAATGAACTGTGAATTCTCGAGAATTCACAGTTCATTAAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172675.1-535s1c1
Sequence:CCGGGCACAGTCTGACTACCTGAAACTCGAGTTTCAGGTAGTCAGACTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172675.1-732s1c1
Sequence:CCGGGCAGTCCATTTCAGACCTCAACTCGAGTTGAGGTCTGAAATGGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089317    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172675.1-621s1c1
Sequence:CCGGTGGAGATGATGCTACTCTGTACTCGAGTACAGAGTAGCATCATCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172675.1-300s1c1
Sequence:CCGGCCTTCATGATAAGCATTTGAACTCGAGTTCAAATGCTTATCATGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172675.4-266s21c1
Sequence:GTACCGGTATGATGTTGGCCGCATTAAACTCGAGTTTAATGCGGCCAACATCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380584    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172675.4-1451s21c1
Sequence:GTACCGGGAAGTCCTTCAAGGATTTATACTCGAGTATAAATCCTTGAAGGACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380507    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172675.4-1008s21c1
Sequence:GTACCGGGTGCTACTGTGTGGATTATTGCTCGAGCAATAATCCACACAGTAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172675
VALIDATED
STX16 MISSION shRNA shRNA Plasmid DNA
syntaxin 16
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000089313    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172675.1-1812s1c1
Sequence:CCGGCCGTTTAATGAACTGTGAATTCTCGAGAATTCACAGTTCATTAAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172675.1-535s1c1
Sequence:CCGGGCACAGTCTGACTACCTGAAACTCGAGTTTCAGGTAGTCAGACTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172675.1-732s1c1
Sequence:CCGGGCAGTCCATTTCAGACCTCAACTCGAGTTGAGGTCTGAAATGGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089317    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172675.1-621s1c1
Sequence:CCGGTGGAGATGATGCTACTCTGTACTCGAGTACAGAGTAGCATCATCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172675.1-300s1c1
Sequence:CCGGCCTTCATGATAAGCATTTGAACTCGAGTTCAAATGCTTATCATGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172675.4-266s21c1
Sequence:GTACCGGTATGATGTTGGCCGCATTAAACTCGAGTTTAATGCGGCCAACATCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380584    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172675.4-1451s21c1
Sequence:GTACCGGGAAGTCCTTCAAGGATTTATACTCGAGTATAAATCCTTGAAGGACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380507    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172675.4-1008s21c1
Sequence:GTACCGGGTGCTACTGTGTGGATTATTGCTCGAGCAATAATCCACACAGTAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172675
VALIDATED
STX16 MISSION shRNA Lentiviral Transduction Particles
syntaxin 16
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000089313    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172675.1-1812s1c1
Sequence:CCGGCCGTTTAATGAACTGTGAATTCTCGAGAATTCACAGTTCATTAAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172675.1-535s1c1
Sequence:CCGGGCACAGTCTGACTACCTGAAACTCGAGTTTCAGGTAGTCAGACTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172675.1-732s1c1
Sequence:CCGGGCAGTCCATTTCAGACCTCAACTCGAGTTGAGGTCTGAAATGGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089317    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172675.1-621s1c1
Sequence:CCGGTGGAGATGATGCTACTCTGTACTCGAGTACAGAGTAGCATCATCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089315    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172675.1-300s1c1
Sequence:CCGGCCTTCATGATAAGCATTTGAACTCGAGTTCAAATGCTTATCATGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172675.4-266s21c1
Sequence:GTACCGGTATGATGTTGGCCGCATTAAACTCGAGTTTAATGCGGCCAACATCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380584    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172675.4-1451s21c1
Sequence:GTACCGGGAAGTCCTTCAAGGATTTATACTCGAGTATAAATCCTTGAAGGACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380507    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172675.4-1008s21c1
Sequence:GTACCGGGTGCTACTGTGTGGATTATTGCTCGAGCAATAATCCACACAGTAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003763
VALIDATED
STX16 MISSION shRNA Bacterial Glycerol Stock
syntaxin 16
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166416    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003763.2-858s1c1
Sequence:CCGGCGAGAGATTCGCCAGATTGTACTCGAGTACAATCTGGCGAATCTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165099    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003763.2-524s1c1
Sequence:CCGGCCAAGAGATCACTCAGCTCTTCTCGAGAAGAGCTGAGTGATCTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161930    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003763.2-507s1c1
Sequence:CCGGGCCATTGAGATAACTACCCAACTCGAGTTGGGTAGTTATCTCAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161981    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003763.2-1040s1c1
Sequence:CCGGGAATCGGAAGATGCTTGTGATCTCGAGATCACAAGCATCTTCCGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162031    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003763.2-922s1c1
Sequence:CCGGCGATGATTGTAGAACAGGGTACTCGAGTACCCTGTTCTACAATCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162176    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003763.2-968s1c1
Sequence:CCGGCGTTGAACAGTCCTGTATCAACTCGAGTTGATACAGGACTGTTCAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166215    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003763.2-702s1c1
Sequence:CCGGCGCATGAAGAATCGAGAGGAACTCGAGTTCCTCTCGATTCTTCATGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003763.3-763s21c1
Sequence:GTACCGGTTCTTGTTGTTGCGGAATAATCTCGAGATTATTCCGCAACAACAAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003763.3-1568s21c1
Sequence:GTACCGGATCGGAAGATGCTTGTGATTTCTCGAGAAATCACAAGCATCTTCCGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218497    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003763.3-1025s21c1
Sequence:GTACCGGAGGAACATGCCATTGAGATAACTCGAGTTATCTCAATGGCATGTTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219995    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_003763.3-4599s1c1
Sequence:CCGGCTAATTGAGAGAGCGTTATTTCTCGAGAAATAACGCTCTCTCAATTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219994    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_003763.3-2833s1c1
Sequence:CCGGCATCGTTTACCTACCTATTATCTCGAGATAATAGGTAGGTAAACGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229992    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003763.3-2833s21c1
Sequence:CCGGCATCGTTTACCTACCTATTATCTCGAGATAATAGGTAGGTAAACGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229991    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003763.3-930s21c1
Sequence:CCGGGTATGATGTTGGCCGGATTAACTCGAGTTAATCCGGCCAACATCATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003763
VALIDATED
STX16 MISSION shRNA shRNA Plasmid DNA
syntaxin 16
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166416    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003763.2-858s1c1
Sequence:CCGGCGAGAGATTCGCCAGATTGTACTCGAGTACAATCTGGCGAATCTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165099    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003763.2-524s1c1
Sequence:CCGGCCAAGAGATCACTCAGCTCTTCTCGAGAAGAGCTGAGTGATCTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161930    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003763.2-507s1c1
Sequence:CCGGGCCATTGAGATAACTACCCAACTCGAGTTGGGTAGTTATCTCAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161981    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003763.2-1040s1c1
Sequence:CCGGGAATCGGAAGATGCTTGTGATCTCGAGATCACAAGCATCTTCCGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162031    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003763.2-922s1c1
Sequence:CCGGCGATGATTGTAGAACAGGGTACTCGAGTACCCTGTTCTACAATCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162176    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003763.2-968s1c1
Sequence:CCGGCGTTGAACAGTCCTGTATCAACTCGAGTTGATACAGGACTGTTCAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166215    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003763.2-702s1c1
Sequence:CCGGCGCATGAAGAATCGAGAGGAACTCGAGTTCCTCTCGATTCTTCATGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003763.3-763s21c1
Sequence:GTACCGGTTCTTGTTGTTGCGGAATAATCTCGAGATTATTCCGCAACAACAAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003763.3-1568s21c1
Sequence:GTACCGGATCGGAAGATGCTTGTGATTTCTCGAGAAATCACAAGCATCTTCCGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218497    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003763.3-1025s21c1
Sequence:GTACCGGAGGAACATGCCATTGAGATAACTCGAGTTATCTCAATGGCATGTTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219995    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_003763.3-4599s1c1
Sequence:CCGGCTAATTGAGAGAGCGTTATTTCTCGAGAAATAACGCTCTCTCAATTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219994    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_003763.3-2833s1c1
Sequence:CCGGCATCGTTTACCTACCTATTATCTCGAGATAATAGGTAGGTAAACGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229992    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003763.3-2833s21c1
Sequence:CCGGCATCGTTTACCTACCTATTATCTCGAGATAATAGGTAGGTAAACGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229991    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003763.3-930s21c1
Sequence:CCGGGTATGATGTTGGCCGGATTAACTCGAGTTAATCCGGCCAACATCATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003763
VALIDATED
STX16 MISSION shRNA Lentiviral Transduction Particles
syntaxin 16
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166416    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003763.2-858s1c1
Sequence:CCGGCGAGAGATTCGCCAGATTGTACTCGAGTACAATCTGGCGAATCTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165099    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003763.2-524s1c1
Sequence:CCGGCCAAGAGATCACTCAGCTCTTCTCGAGAAGAGCTGAGTGATCTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161930    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003763.2-507s1c1
Sequence:CCGGGCCATTGAGATAACTACCCAACTCGAGTTGGGTAGTTATCTCAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161981    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003763.2-1040s1c1
Sequence:CCGGGAATCGGAAGATGCTTGTGATCTCGAGATCACAAGCATCTTCCGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162031    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003763.2-922s1c1
Sequence:CCGGCGATGATTGTAGAACAGGGTACTCGAGTACCCTGTTCTACAATCATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162176    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003763.2-968s1c1
Sequence:CCGGCGTTGAACAGTCCTGTATCAACTCGAGTTGATACAGGACTGTTCAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166215    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003763.2-702s1c1
Sequence:CCGGCGCATGAAGAATCGAGAGGAACTCGAGTTCCTCTCGATTCTTCATGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218044    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003763.3-763s21c1
Sequence:GTACCGGTTCTTGTTGTTGCGGAATAATCTCGAGATTATTCCGCAACAACAAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003763.3-1568s21c1
Sequence:GTACCGGATCGGAAGATGCTTGTGATTTCTCGAGAAATCACAAGCATCTTCCGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218497    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003763.3-1025s21c1
Sequence:GTACCGGAGGAACATGCCATTGAGATAACTCGAGTTATCTCAATGGCATGTTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219995    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_003763.3-4599s1c1
Sequence:CCGGCTAATTGAGAGAGCGTTATTTCTCGAGAAATAACGCTCTCTCAATTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219994    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_003763.3-2833s1c1
Sequence:CCGGCATCGTTTACCTACCTATTATCTCGAGATAATAGGTAGGTAAACGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229992    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003763.3-2833s21c1
Sequence:CCGGCATCGTTTACCTACCTATTATCTCGAGATAATAGGTAGGTAAACGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229991    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003763.3-930s21c1
Sequence:CCGGGTATGATGTTGGCCGGATTAACTCGAGTTAATCCGGCCAACATCATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks