EMAIL THIS PAGE TO A FRIEND

STX17

syntaxin 17

UniProtKB ID: P56962, Q4VXC2
Gene ID:
Mouse(67727) syntaxin 17
Rat(252853) syntaxin 17
Zebrafish(492808) syntaxin 17
Horse(100054797) syntaxin 17
dog(481630) syntaxin 17
chicken(420995) syntaxin 17
cow(534304) syntaxin 17
sheep(101122499) syntaxin 17
84 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026343 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026343 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026343 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_017919 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017919 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017919 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017919 Rosetta Predictions human pricing
NM_145723 Rosetta Predictions rat pricing
NM_026343 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017919 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00181582 predicted 612
2 SASI_Hs01_00181583 predicted 332
3 SASI_Hs01_00181584 predicted 1058
4 SASI_Hs01_00181585 predicted 394
5 SASI_Hs01_00181586 predicted 515
6 SASI_Hs02_00350907 predicted 238
7 SASI_Hs01_00181589 predicted 459
8 SASI_Hs01_00181590 predicted 569
9 SASI_Hs02_00350908 predicted 669
10 SASI_Hs01_00181588 predicted 654
11 SASI_Hs01_00181587 predicted 641
12 SASI_Hs01_00181591 predicted 597
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145723 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00052440 predicted 679
2 SASI_Rn02_00268743 predicted 687
3 SASI_Rn01_00052443 predicted 360
4 SASI_Rn01_00052445 predicted 876
5 SASI_Rn01_00052446 predicted 582
6 SASI_Rn01_00052447 predicted 651
7 SASI_Rn01_00052448 predicted 243
8 SASI_Rn01_00052449 predicted 1080
9 SASI_Rn02_00268744 predicted 481
10 SASI_Rn02_00268745 predicted 637
11 SASI_Rn01_00052441 predicted 610
12 SASI_Rn01_00052442 predicted 493
13 SASI_Rn01_00052444 predicted 332
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026343 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00168945 predicted 221
2 SASI_Mm01_00168946 predicted 616
3 SASI_Mm01_00168947 predicted 561
4 SASI_Mm01_00168948 predicted 224
5 SASI_Mm02_00330058 predicted 619
6 SASI_Mm01_00168949 predicted 999
7 SASI_Mm01_00168950 predicted 336
8 SASI_Mm01_00168951 predicted 606
9 SASI_Mm01_00168954 predicted 261
10 SASI_Mm02_00330059 predicted 1036
11 SASI_Mm01_00168952 predicted 542
12 SASI_Mm01_00168953 predicted 331
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026343
STX17 MISSION shRNA Bacterial Glycerol Stock
syntaxin 17
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000380730    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026343.2-1246s21c1
Sequence:GTACCGGATCCATAACTAAGGATCTAAGCTCGAGCTTAGATCCTTAGTTATGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379904    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026343.2-1179s21c1
Sequence:GTACCGGGTGTCTGTCAGGTCAAGTTTACTCGAGTAAACTTGACCTGACAGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379687    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026343.2-1295s21c1
Sequence:GTACCGGGTCAGTGTATTTGTCAATTATCTCGAGATAATTGACAAATACACTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026343.2-298s21c1
Sequence:GTACCGGCGCTCCAATATCCGAGAAATGCTCGAGCATTTCTCGGATATTGGAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100675    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026343.1-1122s1c1
Sequence:CCGGGCTGGGTGTTAATGGAGATTTCTCGAGAAATCTCCATTAACACCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026343.1-197s1c1
Sequence:CCGGCCAGATAAACATCGAGAAGTACTCGAGTACTTCTCGATGTTTATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026343.1-539s1c1
Sequence:CCGGTCAGAGTCTGACTCAGATATACTCGAGTATATCTGAGTCAGACTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026343.1-356s1c1
Sequence:CCGGGCGAATGATAGATCCTGTCAACTCGAGTTGACAGGATCTATCATTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026343.1-287s1c1
Sequence:CCGGGCGCTCCAATATCCGAGAAATCTCGAGATTTCTCGGATATTGGAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026343
STX17 MISSION shRNA shRNA Plasmid DNA
syntaxin 17
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000380730    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026343.2-1246s21c1
Sequence:GTACCGGATCCATAACTAAGGATCTAAGCTCGAGCTTAGATCCTTAGTTATGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379904    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026343.2-1179s21c1
Sequence:GTACCGGGTGTCTGTCAGGTCAAGTTTACTCGAGTAAACTTGACCTGACAGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379687    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026343.2-1295s21c1
Sequence:GTACCGGGTCAGTGTATTTGTCAATTATCTCGAGATAATTGACAAATACACTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026343.2-298s21c1
Sequence:GTACCGGCGCTCCAATATCCGAGAAATGCTCGAGCATTTCTCGGATATTGGAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100675    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026343.1-1122s1c1
Sequence:CCGGGCTGGGTGTTAATGGAGATTTCTCGAGAAATCTCCATTAACACCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026343.1-197s1c1
Sequence:CCGGCCAGATAAACATCGAGAAGTACTCGAGTACTTCTCGATGTTTATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026343.1-539s1c1
Sequence:CCGGTCAGAGTCTGACTCAGATATACTCGAGTATATCTGAGTCAGACTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026343.1-356s1c1
Sequence:CCGGGCGAATGATAGATCCTGTCAACTCGAGTTGACAGGATCTATCATTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026343.1-287s1c1
Sequence:CCGGGCGCTCCAATATCCGAGAAATCTCGAGATTTCTCGGATATTGGAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026343
STX17 MISSION shRNA Lentiviral Transduction Particles
syntaxin 17
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000380730    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026343.2-1246s21c1
Sequence:GTACCGGATCCATAACTAAGGATCTAAGCTCGAGCTTAGATCCTTAGTTATGGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379904    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026343.2-1179s21c1
Sequence:GTACCGGGTGTCTGTCAGGTCAAGTTTACTCGAGTAAACTTGACCTGACAGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379687    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026343.2-1295s21c1
Sequence:GTACCGGGTCAGTGTATTTGTCAATTATCTCGAGATAATTGACAAATACACTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379887    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026343.2-298s21c1
Sequence:GTACCGGCGCTCCAATATCCGAGAAATGCTCGAGCATTTCTCGGATATTGGAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100675    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026343.1-1122s1c1
Sequence:CCGGGCTGGGTGTTAATGGAGATTTCTCGAGAAATCTCCATTAACACCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026343.1-197s1c1
Sequence:CCGGCCAGATAAACATCGAGAAGTACTCGAGTACTTCTCGATGTTTATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026343.1-539s1c1
Sequence:CCGGTCAGAGTCTGACTCAGATATACTCGAGTATATCTGAGTCAGACTCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100677    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026343.1-356s1c1
Sequence:CCGGGCGAATGATAGATCCTGTCAACTCGAGTTGACAGGATCTATCATTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100676    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026343.1-287s1c1
Sequence:CCGGGCGCTCCAATATCCGAGAAATCTCGAGATTTCTCGGATATTGGAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017919
VALIDATED
STX17 MISSION shRNA Bacterial Glycerol Stock
syntaxin 17
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000380045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017919.2-400s21c1
Sequence:GTACCGGGAGAATGATAGATCCTGTTAACTCGAGTTAACAGGATCTATCATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379933    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_017919.2-1476s21c1
Sequence:GTACCGGTTGTTATCAGATAGCGAAATCCTCGAGGATTTCGCTATCTGATAACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_017919.2-181s21c1
Sequence:GTACCGGAGCTATCCAGAAATTCATTAACTCGAGTTAATGAATTTCTGGATAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380461    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_017919.2-467s21c1
Sequence:GTACCGGGAATCTGTAGAAGAACTTAAGCTCGAGCTTAAGTTCTTCTACAGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017919.2-288s21c1
Sequence:GTACCGGTGCATGAAGAGCATATCAATGCTCGAGCATTGATATGCTCTTCATGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060121    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_017919.1-392s1c1
Sequence:CCGGGCAGAATTTCTCCAACTCCATCTCGAGATGGAGTTGGAGAAATTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_017919.1-128s1c1
Sequence:CCGGCCAGCTATCCAGAAATTCATTCTCGAGAATGAATTTCTGGATAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060119    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_017919.1-281s1c1
Sequence:CCGGCGATCCAATATCCGAGAAATTCTCGAGAATTTCTCGGATATTGGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060118    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_017919.1-1690s1c1
Sequence:CCGGCCTGTCTTCTAACACCTCAAACTCGAGTTTGAGGTGTTAGAAGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017919
VALIDATED
STX17 MISSION shRNA shRNA Plasmid DNA
syntaxin 17
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000380045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017919.2-400s21c1
Sequence:GTACCGGGAGAATGATAGATCCTGTTAACTCGAGTTAACAGGATCTATCATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379933    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_017919.2-1476s21c1
Sequence:GTACCGGTTGTTATCAGATAGCGAAATCCTCGAGGATTTCGCTATCTGATAACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_017919.2-181s21c1
Sequence:GTACCGGAGCTATCCAGAAATTCATTAACTCGAGTTAATGAATTTCTGGATAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380461    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_017919.2-467s21c1
Sequence:GTACCGGGAATCTGTAGAAGAACTTAAGCTCGAGCTTAAGTTCTTCTACAGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017919.2-288s21c1
Sequence:GTACCGGTGCATGAAGAGCATATCAATGCTCGAGCATTGATATGCTCTTCATGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060121    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_017919.1-392s1c1
Sequence:CCGGGCAGAATTTCTCCAACTCCATCTCGAGATGGAGTTGGAGAAATTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_017919.1-128s1c1
Sequence:CCGGCCAGCTATCCAGAAATTCATTCTCGAGAATGAATTTCTGGATAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060119    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_017919.1-281s1c1
Sequence:CCGGCGATCCAATATCCGAGAAATTCTCGAGAATTTCTCGGATATTGGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060118    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_017919.1-1690s1c1
Sequence:CCGGCCTGTCTTCTAACACCTCAAACTCGAGTTTGAGGTGTTAGAAGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017919
VALIDATED
STX17 MISSION shRNA Lentiviral Transduction Particles
syntaxin 17
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000380045    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017919.2-400s21c1
Sequence:GTACCGGGAGAATGATAGATCCTGTTAACTCGAGTTAACAGGATCTATCATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379933    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_017919.2-1476s21c1
Sequence:GTACCGGTTGTTATCAGATAGCGAAATCCTCGAGGATTTCGCTATCTGATAACAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_017919.2-181s21c1
Sequence:GTACCGGAGCTATCCAGAAATTCATTAACTCGAGTTAATGAATTTCTGGATAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380461    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_017919.2-467s21c1
Sequence:GTACCGGGAATCTGTAGAAGAACTTAAGCTCGAGCTTAAGTTCTTCTACAGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017919.2-288s21c1
Sequence:GTACCGGTGCATGAAGAGCATATCAATGCTCGAGCATTGATATGCTCTTCATGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060121    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_017919.1-392s1c1
Sequence:CCGGGCAGAATTTCTCCAACTCCATCTCGAGATGGAGTTGGAGAAATTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_017919.1-128s1c1
Sequence:CCGGCCAGCTATCCAGAAATTCATTCTCGAGAATGAATTTCTGGATAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060119    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_017919.1-281s1c1
Sequence:CCGGCGATCCAATATCCGAGAAATTCTCGAGAATTTCTCGGATATTGGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060118    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_017919.1-1690s1c1
Sequence:CCGGCCTGTCTTCTAACACCTCAAACTCGAGTTTGAGGTGTTAGAAGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks