EMAIL THIS PAGE TO A FRIEND

STX18

syntaxin 18

Synonyms: Ufe1
UniProtKB ID: Q9P2W9, Q596L3, Q5TZP5
Gene ID:
Mouse(71116) syntaxin 18
Rat(360953) syntaxin 18
cow(614135) syntaxin 18
sheep(101103647) syntaxin 18
Zebrafish(554130) syntaxin 18
dog(609342) syntaxin 18
chicken(422848) syntaxin 18
50 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016930 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016930 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016930 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026959 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026959 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026959 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016930 Rosetta Predictions human pricing
NM_001012151 Rosetta Predictions rat pricing
NM_026959 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016930 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00349916 predicted 381
2 SASI_Hs01_00075445 predicted 919
3 SASI_Hs01_00075446 predicted 979
4 SASI_Hs01_00075447 predicted 804
5 SASI_Hs01_00075448 predicted 928
6 SASI_Hs01_00075449 predicted 980
7 SASI_Hs02_00349917 predicted 353
8 SASI_Hs01_00075450 predicted 675
9 SASI_Hs01_00075451 predicted 830
10 SASI_Hs01_00075452 predicted 595
11 SASI_Hs01_00075444 predicted 1147
12 SASI_Hs01_00075453 predicted 449
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012151 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00113331 predicted 905
2 SASI_Rn01_00113333 predicted 853
3 SASI_Rn01_00113334 predicted 902
4 SASI_Rn01_00113335 predicted 311
5 SASI_Rn01_00113336 predicted 556
6 SASI_Rn01_00113337 predicted 557
7 SASI_Rn01_00113338 predicted 336
8 SASI_Rn01_00113339 predicted 727
9 SASI_Rn02_00200330 predicted 539
10 SASI_Rn01_00113340 predicted 754
11 SASI_Rn01_00113332 predicted 452
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026959 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00040380 predicted 392
2 SASI_Mm01_00040382 predicted 530
3 SASI_Mm01_00040383 predicted 927
4 SASI_Mm01_00040384 predicted 414
5 SASI_Mm01_00040385 predicted 807
6 SASI_Mm01_00040386 predicted 936
7 SASI_Mm01_00040387 predicted 624
8 SASI_Mm01_00040388 predicted 1238
9 SASI_Mm01_00040389 predicted 836
10 SASI_Mm02_00331277 predicted 549
11 SASI_Mm01_00040381 predicted 414
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016930
VALIDATED
STX18 MISSION shRNA Bacterial Glycerol Stock
syntaxin 18
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000137053    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016930.2-1433s1c1
Sequence:CCGGCCTAATTGTCTCAGGGTTCAACTCGAGTTGAACCCTGAGACAATTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016930.2-804s1c1
Sequence:CCGGGCGACTAATTGGTGAAATGAACTCGAGTTCATTTCACCAATTAGTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016930.2-286s1c1
Sequence:CCGGCTGGAACACAGGAAAGATTATCTCGAGATAATCTTTCCTGTGTTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016930.2-244s1c1
Sequence:CCGGCGCGAAGTGATTTCTCACATTCTCGAGAATGTGAGAAATCACTTCGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167407    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016930.2-1565s1c1
Sequence:CCGGGTCAACGAATACACAGACTTACTCGAGTAAGTCTGTGTATTCGTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319349    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016930.2-1433s21c1
Sequence:CCGGCCTAATTGTCTCAGGGTTCAACTCGAGTTGAACCCTGAGACAATTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016930.2-804s21c1
Sequence:CCGGGCGACTAATTGGTGAAATGAACTCGAGTTCATTTCACCAATTAGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016930.2-286s21c1
Sequence:CCGGCTGGAACACAGGAAAGATTATCTCGAGATAATCTTTCCTGTGTTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016930.2-244s21c1
Sequence:CCGGCGCGAAGTGATTTCTCACATTCTCGAGAATGTGAGAAATCACTTCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_016930.2-746s21c1
Sequence:GTACCGGGCAAAGGCGAAGATGAGTTATCTCGAGATAACTCATCTTCGCCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380615    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016930.2-537s21c1
Sequence:GTACCGGACAGAGAGCCATCCGAGTTAACTCGAGTTAACTCGGATGGCTCTCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382254    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_016930.2-985s21c1
Sequence:GTACCGGGACATAAGAGAGGCCATTAAACTCGAGTTTAATGGCCTCTCTTATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016930.2-373s21c1
Sequence:GTACCGGGACCAGGATGCCCAGATATTCCTCGAGGAATATCTGGGCATCCTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016930
VALIDATED
STX18 MISSION shRNA shRNA Plasmid DNA
syntaxin 18
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000137053    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016930.2-1433s1c1
Sequence:CCGGCCTAATTGTCTCAGGGTTCAACTCGAGTTGAACCCTGAGACAATTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016930.2-804s1c1
Sequence:CCGGGCGACTAATTGGTGAAATGAACTCGAGTTCATTTCACCAATTAGTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016930.2-286s1c1
Sequence:CCGGCTGGAACACAGGAAAGATTATCTCGAGATAATCTTTCCTGTGTTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016930.2-244s1c1
Sequence:CCGGCGCGAAGTGATTTCTCACATTCTCGAGAATGTGAGAAATCACTTCGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167407    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016930.2-1565s1c1
Sequence:CCGGGTCAACGAATACACAGACTTACTCGAGTAAGTCTGTGTATTCGTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319349    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016930.2-1433s21c1
Sequence:CCGGCCTAATTGTCTCAGGGTTCAACTCGAGTTGAACCCTGAGACAATTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016930.2-804s21c1
Sequence:CCGGGCGACTAATTGGTGAAATGAACTCGAGTTCATTTCACCAATTAGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016930.2-286s21c1
Sequence:CCGGCTGGAACACAGGAAAGATTATCTCGAGATAATCTTTCCTGTGTTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016930.2-244s21c1
Sequence:CCGGCGCGAAGTGATTTCTCACATTCTCGAGAATGTGAGAAATCACTTCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_016930.2-746s21c1
Sequence:GTACCGGGCAAAGGCGAAGATGAGTTATCTCGAGATAACTCATCTTCGCCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380615    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016930.2-537s21c1
Sequence:GTACCGGACAGAGAGCCATCCGAGTTAACTCGAGTTAACTCGGATGGCTCTCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382254    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_016930.2-985s21c1
Sequence:GTACCGGGACATAAGAGAGGCCATTAAACTCGAGTTTAATGGCCTCTCTTATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016930.2-373s21c1
Sequence:GTACCGGGACCAGGATGCCCAGATATTCCTCGAGGAATATCTGGGCATCCTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016930
VALIDATED
STX18 MISSION shRNA Lentiviral Transduction Particles
syntaxin 18
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000137053    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016930.2-1433s1c1
Sequence:CCGGCCTAATTGTCTCAGGGTTCAACTCGAGTTGAACCCTGAGACAATTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016930.2-804s1c1
Sequence:CCGGGCGACTAATTGGTGAAATGAACTCGAGTTCATTTCACCAATTAGTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133821    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016930.2-286s1c1
Sequence:CCGGCTGGAACACAGGAAAGATTATCTCGAGATAATCTTTCCTGTGTTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136717    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016930.2-244s1c1
Sequence:CCGGCGCGAAGTGATTTCTCACATTCTCGAGAATGTGAGAAATCACTTCGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167407    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016930.2-1565s1c1
Sequence:CCGGGTCAACGAATACACAGACTTACTCGAGTAAGTCTGTGTATTCGTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319349    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016930.2-1433s21c1
Sequence:CCGGCCTAATTGTCTCAGGGTTCAACTCGAGTTGAACCCTGAGACAATTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319348    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016930.2-804s21c1
Sequence:CCGGGCGACTAATTGGTGAAATGAACTCGAGTTCATTTCACCAATTAGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016930.2-286s21c1
Sequence:CCGGCTGGAACACAGGAAAGATTATCTCGAGATAATCTTTCCTGTGTTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319346    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016930.2-244s21c1
Sequence:CCGGCGCGAAGTGATTTCTCACATTCTCGAGAATGTGAGAAATCACTTCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379402    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_016930.2-746s21c1
Sequence:GTACCGGGCAAAGGCGAAGATGAGTTATCTCGAGATAACTCATCTTCGCCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380615    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016930.2-537s21c1
Sequence:GTACCGGACAGAGAGCCATCCGAGTTAACTCGAGTTAACTCGGATGGCTCTCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382254    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_016930.2-985s21c1
Sequence:GTACCGGGACATAAGAGAGGCCATTAAACTCGAGTTTAATGGCCTCTCTTATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016930.2-373s21c1
Sequence:GTACCGGGACCAGGATGCCCAGATATTCCTCGAGGAATATCTGGGCATCCTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026959
VALIDATED
STX18 MISSION shRNA Bacterial Glycerol Stock
syntaxin 18
Mouse
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000100565    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026959.1-1248s1c1
Sequence:CCGGGACTGAGCAGAGCAAGGAAATCTCGAGATTTCCTTGCTCTGCTCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026959.1-817s1c1
Sequence:CCGGGCGACTCATTGGTGAAATGAACTCGAGTTCATTTCACCAATGAGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026959.1-823s1c1
Sequence:CCGGCATTGGTGAAATGAACAGCTTCTCGAGAAGCTGTTCATTTCACCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100569    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026959.1-865s1c1
Sequence:CCGGCGAAGGGAAAGTCGTTGAAATCTCGAGATTTCAACGACTTTCCCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026959.1-260s1c1
Sequence:CCGGCGTGAAGTGATTTCTCACATTCTCGAGAATGTGAGAAATCACTTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382438    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026959.2-1233s21c1
Sequence:GTACCGGACCTCTCAGGACCTGGAAATACTCGAGTATTTCCAGGTCCTGAGAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337664    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026959.2-302s21c1
Sequence:CCGGGAGCACAGGAAGGAGTATATTCTCGAGAATATACTCCTTCCTGTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026959.2-504s21c1
Sequence:CCGGATTTCGTTGACGATTACTTAACTCGAGTTAAGTAATCGTCAACGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337732    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026959.2-1360s21c1
Sequence:CCGGCAGGCCTCCTATCTCCATTACCTCGAGGTAATGGAGATAGGAGGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026959.2-139s21c1
Sequence:CCGGGACAGTGAAGACGCGGAATAACTCGAGTTATTCCGCGTCTTCACTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376941    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026959.2-333s21c1
Sequence:CCGGGCCACACCATGTCTGACTATGCTCGAGCATAGTCAGACATGGTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376940    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026959.2-1149s21c1
Sequence:CCGGACGTGCCAGCATGTGTCTCATCTCGAGATGAGACACATGCTGGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026959.2-274s21c1
Sequence:GTACCGGCATTGGGAAGCTGAGAGATTTCTCGAGAAATCTCTCAGCTTCCCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026959.2-386s21c1
Sequence:GTACCGGGACCAGGATGCTCAGATATTCCTCGAGGAATATCTGAGCATCCTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380650    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026959.2-936s21c1
Sequence:GTACCGGTCGACAGCATTCACCAGTTAGCTCGAGCTAACTGGTGAATGCTGTCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026959
VALIDATED
STX18 MISSION shRNA shRNA Plasmid DNA
syntaxin 18
Mouse
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000100565    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026959.1-1248s1c1
Sequence:CCGGGACTGAGCAGAGCAAGGAAATCTCGAGATTTCCTTGCTCTGCTCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026959.1-817s1c1
Sequence:CCGGGCGACTCATTGGTGAAATGAACTCGAGTTCATTTCACCAATGAGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026959.1-823s1c1
Sequence:CCGGCATTGGTGAAATGAACAGCTTCTCGAGAAGCTGTTCATTTCACCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100569    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026959.1-865s1c1
Sequence:CCGGCGAAGGGAAAGTCGTTGAAATCTCGAGATTTCAACGACTTTCCCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026959.1-260s1c1
Sequence:CCGGCGTGAAGTGATTTCTCACATTCTCGAGAATGTGAGAAATCACTTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382438    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026959.2-1233s21c1
Sequence:GTACCGGACCTCTCAGGACCTGGAAATACTCGAGTATTTCCAGGTCCTGAGAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337664    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026959.2-302s21c1
Sequence:CCGGGAGCACAGGAAGGAGTATATTCTCGAGAATATACTCCTTCCTGTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026959.2-504s21c1
Sequence:CCGGATTTCGTTGACGATTACTTAACTCGAGTTAAGTAATCGTCAACGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337732    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026959.2-1360s21c1
Sequence:CCGGCAGGCCTCCTATCTCCATTACCTCGAGGTAATGGAGATAGGAGGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026959.2-139s21c1
Sequence:CCGGGACAGTGAAGACGCGGAATAACTCGAGTTATTCCGCGTCTTCACTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376941    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026959.2-333s21c1
Sequence:CCGGGCCACACCATGTCTGACTATGCTCGAGCATAGTCAGACATGGTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376940    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026959.2-1149s21c1
Sequence:CCGGACGTGCCAGCATGTGTCTCATCTCGAGATGAGACACATGCTGGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026959.2-274s21c1
Sequence:GTACCGGCATTGGGAAGCTGAGAGATTTCTCGAGAAATCTCTCAGCTTCCCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026959.2-386s21c1
Sequence:GTACCGGGACCAGGATGCTCAGATATTCCTCGAGGAATATCTGAGCATCCTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380650    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026959.2-936s21c1
Sequence:GTACCGGTCGACAGCATTCACCAGTTAGCTCGAGCTAACTGGTGAATGCTGTCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026959
VALIDATED
STX18 MISSION shRNA Lentiviral Transduction Particles
syntaxin 18
Mouse
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000100565    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026959.1-1248s1c1
Sequence:CCGGGACTGAGCAGAGCAAGGAAATCTCGAGATTTCCTTGCTCTGCTCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026959.1-817s1c1
Sequence:CCGGGCGACTCATTGGTGAAATGAACTCGAGTTCATTTCACCAATGAGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026959.1-823s1c1
Sequence:CCGGCATTGGTGAAATGAACAGCTTCTCGAGAAGCTGTTCATTTCACCAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100569    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026959.1-865s1c1
Sequence:CCGGCGAAGGGAAAGTCGTTGAAATCTCGAGATTTCAACGACTTTCCCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100566    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026959.1-260s1c1
Sequence:CCGGCGTGAAGTGATTTCTCACATTCTCGAGAATGTGAGAAATCACTTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382438    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026959.2-1233s21c1
Sequence:GTACCGGACCTCTCAGGACCTGGAAATACTCGAGTATTTCCAGGTCCTGAGAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337664    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026959.2-302s21c1
Sequence:CCGGGAGCACAGGAAGGAGTATATTCTCGAGAATATACTCCTTCCTGTGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026959.2-504s21c1
Sequence:CCGGATTTCGTTGACGATTACTTAACTCGAGTTAAGTAATCGTCAACGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337732    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026959.2-1360s21c1
Sequence:CCGGCAGGCCTCCTATCTCCATTACCTCGAGGTAATGGAGATAGGAGGCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026959.2-139s21c1
Sequence:CCGGGACAGTGAAGACGCGGAATAACTCGAGTTATTCCGCGTCTTCACTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376941    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026959.2-333s21c1
Sequence:CCGGGCCACACCATGTCTGACTATGCTCGAGCATAGTCAGACATGGTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376940    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026959.2-1149s21c1
Sequence:CCGGACGTGCCAGCATGTGTCTCATCTCGAGATGAGACACATGCTGGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379454    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026959.2-274s21c1
Sequence:GTACCGGCATTGGGAAGCTGAGAGATTTCTCGAGAAATCTCTCAGCTTCCCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026959.2-386s21c1
Sequence:GTACCGGGACCAGGATGCTCAGATATTCCTCGAGGAATATCTGAGCATCCTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380650    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026959.2-936s21c1
Sequence:GTACCGGTCGACAGCATTCACCAGTTAGCTCGAGCTAACTGGTGAATGCTGTCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks