EMAIL THIS PAGE TO A FRIEND

STX19

syntaxin 19

UniProtKB ID: Q8N4C7
Gene ID:
Mouse(68159) syntaxin 19
Rat(685180) syntaxin 19
chicken(770351) syntaxin 19
dog(487933) syntaxin 19
cow(514487) syntaxin 19
sheep(101123255) syntaxin 19
47 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026588 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026588 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026588 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001001850 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001001850 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001001850 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001001850 Rosetta Predictions human pricing
NM_001109460 Rosetta Predictions rat pricing
NM_026588 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001850 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00052168 predicted 780
2 SASI_Hs01_00052169 predicted 804
3 SASI_Hs01_00052170 predicted 782
4 SASI_Hs01_00052172 predicted 499
5 SASI_Hs01_00052173 predicted 260
6 SASI_Hs01_00052174 predicted 485
7 SASI_Hs01_00052175 predicted 347
8 SASI_Hs01_00052176 predicted 315
9 SASI_Hs01_00052177 predicted 682
10 SASI_Hs02_00303957 predicted 640
11 SASI_Hs01_00052171 predicted 292
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109460 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00248627 predicted 511
2 SASI_Rn02_00248628 predicted 657
3 SASI_Rn02_00248629 predicted 277
4 SASI_Rn02_00248630 predicted 599
5 SASI_Rn02_00248631 predicted 436
6 SASI_Rn02_00248632 predicted 540
7 SASI_Rn02_00248633 predicted 697
8 SASI_Rn02_00248634 predicted 413
9 SASI_Rn02_00248635 predicted 898
10 SASI_Rn02_00248636 predicted 858
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026588 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00181625 predicted 921
2 SASI_Mm01_00181626 predicted 732
3 SASI_Mm01_00181627 predicted 521
4 SASI_Mm01_00181628 predicted 385
5 SASI_Mm01_00181629 predicted 426
6 SASI_Mm01_00181631 predicted 470
7 SASI_Mm02_00330551 predicted 386
8 SASI_Mm01_00181632 predicted 521
9 SASI_Mm01_00181633 predicted 507
10 SASI_Mm01_00181634 predicted 899
11 SASI_Mm01_00181630 predicted 773
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026588
STX19 MISSION shRNA Bacterial Glycerol Stock
syntaxin 19
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000452757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026588.1-605s21c1
Sequence:CCGGCACTGGGTGACGTAGTCAAAGCTCGAGCTTTGACTACGTCACCCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000450864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026588.1-1080s21c1
Sequence:CCGGGAAATTTGGACTGGCTGTAAACTCGAGTTTACAGCCAGTCCAAATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026588.1-872s1c1
Sequence:CCGGGCTTACTTACAGAAACCAGTACTCGAGTACTGGTTTCTGTAAGTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026588.1-528s1c1
Sequence:CCGGGAGAAGGTTTAGTCTACTTAACTCGAGTTAAGTAGACTAAACCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026588.1-475s1c1
Sequence:CCGGGTGGATGATGTTCAACGATTTCTCGAGAAATCGTTGAACATCATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026588.1-523s1c1
Sequence:CCGGTCCATGAGAAGGTTTAGTCTACTCGAGTAGACTAAACCTTCTCATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026588.1-714s1c1
Sequence:CCGGCCAGCAAACCATGTTTCTATACTCGAGTATAGAAACATGGTTTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026588
STX19 MISSION shRNA shRNA Plasmid DNA
syntaxin 19
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000452757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026588.1-605s21c1
Sequence:CCGGCACTGGGTGACGTAGTCAAAGCTCGAGCTTTGACTACGTCACCCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000450864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026588.1-1080s21c1
Sequence:CCGGGAAATTTGGACTGGCTGTAAACTCGAGTTTACAGCCAGTCCAAATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026588.1-872s1c1
Sequence:CCGGGCTTACTTACAGAAACCAGTACTCGAGTACTGGTTTCTGTAAGTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026588.1-528s1c1
Sequence:CCGGGAGAAGGTTTAGTCTACTTAACTCGAGTTAAGTAGACTAAACCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026588.1-475s1c1
Sequence:CCGGGTGGATGATGTTCAACGATTTCTCGAGAAATCGTTGAACATCATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026588.1-523s1c1
Sequence:CCGGTCCATGAGAAGGTTTAGTCTACTCGAGTAGACTAAACCTTCTCATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026588.1-714s1c1
Sequence:CCGGCCAGCAAACCATGTTTCTATACTCGAGTATAGAAACATGGTTTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026588
STX19 MISSION shRNA Lentiviral Transduction Particles
syntaxin 19
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000452757    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026588.1-605s21c1
Sequence:CCGGCACTGGGTGACGTAGTCAAAGCTCGAGCTTTGACTACGTCACCCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000450864    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026588.1-1080s21c1
Sequence:CCGGGAAATTTGGACTGGCTGTAAACTCGAGTTTACAGCCAGTCCAAATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026588.1-872s1c1
Sequence:CCGGGCTTACTTACAGAAACCAGTACTCGAGTACTGGTTTCTGTAAGTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026588.1-528s1c1
Sequence:CCGGGAGAAGGTTTAGTCTACTTAACTCGAGTTAAGTAGACTAAACCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100924    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026588.1-475s1c1
Sequence:CCGGGTGGATGATGTTCAACGATTTCTCGAGAAATCGTTGAACATCATCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026588.1-523s1c1
Sequence:CCGGTCCATGAGAAGGTTTAGTCTACTCGAGTAGACTAAACCTTCTCATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026588.1-714s1c1
Sequence:CCGGCCAGCAAACCATGTTTCTATACTCGAGTATAGAAACATGGTTTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001001850
STX19 MISSION shRNA Bacterial Glycerol Stock
syntaxin 19
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000446549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001850.1-638s21c1
Sequence:CCGGAGTGGTCACAAGGATACTTAACTCGAGTTAAGTATCCTTGTGACCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000447192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001850.1-736s21c1
Sequence:CCGGAGAAGTGCAAGACATTTATTTCTCGAGAAATAAATGTCTTGCACTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000448904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001850.1-574s21c1
Sequence:CCGGACAGAAGTTTGAATGATTTAGCTCGAGCTAAATCATTCAAACTTCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001850.1-876s1c1
Sequence:CCGGGCACAACTTTCAGAGATTGAACTCGAGTTCAATCTCTGAAAGTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001850.1-319s1c1
Sequence:CCGGGTCATGTATCAACTACAGAAACTCGAGTTTCTGTAGTTGATACATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001850.1-532s1c1
Sequence:CCGGCTACCATTACAAAGGAGATAACTCGAGTTATCTCCTTTGTAATGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001850.1-710s1c1
Sequence:CCGGCAATGACACAATAGCAGCAAACTCGAGTTTGCTGCTATTGTGTCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001001850
STX19 MISSION shRNA shRNA Plasmid DNA
syntaxin 19
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000446549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001850.1-638s21c1
Sequence:CCGGAGTGGTCACAAGGATACTTAACTCGAGTTAAGTATCCTTGTGACCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000447192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001850.1-736s21c1
Sequence:CCGGAGAAGTGCAAGACATTTATTTCTCGAGAAATAAATGTCTTGCACTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000448904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001850.1-574s21c1
Sequence:CCGGACAGAAGTTTGAATGATTTAGCTCGAGCTAAATCATTCAAACTTCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001850.1-876s1c1
Sequence:CCGGGCACAACTTTCAGAGATTGAACTCGAGTTCAATCTCTGAAAGTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001850.1-319s1c1
Sequence:CCGGGTCATGTATCAACTACAGAAACTCGAGTTTCTGTAGTTGATACATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001850.1-532s1c1
Sequence:CCGGCTACCATTACAAAGGAGATAACTCGAGTTATCTCCTTTGTAATGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001850.1-710s1c1
Sequence:CCGGCAATGACACAATAGCAGCAAACTCGAGTTTGCTGCTATTGTGTCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001001850
STX19 MISSION shRNA Lentiviral Transduction Particles
syntaxin 19
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000446549    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001850.1-638s21c1
Sequence:CCGGAGTGGTCACAAGGATACTTAACTCGAGTTAAGTATCCTTGTGACCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000447192    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001850.1-736s21c1
Sequence:CCGGAGAAGTGCAAGACATTTATTTCTCGAGAAATAAATGTCTTGCACTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000448904    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001001850.1-574s21c1
Sequence:CCGGACAGAAGTTTGAATGATTTAGCTCGAGCTAAATCATTCAAACTTCTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001850.1-876s1c1
Sequence:CCGGGCACAACTTTCAGAGATTGAACTCGAGTTCAATCTCTGAAAGTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001850.1-319s1c1
Sequence:CCGGGTCATGTATCAACTACAGAAACTCGAGTTTCTGTAGTTGATACATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001850.1-532s1c1
Sequence:CCGGCTACCATTACAAAGGAGATAACTCGAGTTATCTCCTTTGTAATGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001001850.1-710s1c1
Sequence:CCGGCAATGACACAATAGCAGCAAACTCGAGTTTGCTGCTATTGTGTCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks