EMAIL THIS PAGE TO A FRIEND

STX1A

syntaxin 1A (brain)

Synonyms: HPC-1 P35-1 STX1 SYN1A
UniProtKB ID: Q16623, O15447, O15448, Q12936, Q75MD9, Q9BPZ6
Gene ID:
Human(6804) Summary: This gene encodes a member of the syntaxin superfamily. Syntaxins are nervous system-specific proteins implicated in the docking of synaptic vesicles with the presynaptic plasma membrane. Syntaxins possess a single C-terminal transmembrane domain, a SNARE [Soluble NSF (N-ethylmaleimide-sensitive fusion protein)-Attachment protein REceptor]
Mouse(20907) syntaxin 1A (brain)
Rat(116470) syntaxin 1A (brain)
cow(788566) syntaxin 1A (brain)
sheep(101112696) syntaxin 1A (brain)
domestic guinea pig(100727115) syntaxin 1A (brain)
naked mole-rat(101701572) syntaxin 1A (brain)
chicken(770216) syntaxin 1A (brain)
domestic cat(101097118) syntaxin 1A (brain)
dog(607840) syntaxin 1A (brain)
93 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4504321 Anti-phospho-Syntaxin 1A (pSer14) antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, western blot pricing
SAB4301555 Anti-phospho-Syntaxin 1A (pSer14) antibody produced in rabbit affinity isolated antibody mouse, rat, human
western blot pricing
SAB1406496 Anti-STX1A antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
immunohistochemistry, western blot pricing
SAB2108435 Anti-STX1A antibody produced in rabbit affinity isolated antibody mouse, human, guinea pig, horse, rabbit
western blot pricing
SAB2102329 Anti-STX1A antibody produced in rabbit affinity isolated antibody bovine, rat, zebrafish, human, mouse, guinea pig
western blot pricing
SAB2107400 Anti-STX1A antibody produced in rabbit affinity isolated antibody, lyophilized powder horse, mouse, human, rabbit
ELISA, western blot pricing
HPA069176 Anti-STX1A antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunohistochemistry pricing
SAB2501001 Anti-STX1A/STX1B2 antibody produced in goat affinity isolated antibody, buffered aqueous solution mouse, human, canine, rat
ELISA, western blot pricing
S1172 Anti-Syntaxin 1 antibody produced in rabbit IgG fraction of antiserum, lyophilized powder rat, mouse
immunohistochemistry, western blot pricing
SAB5500181 Anti-Syntaxin 1A antibody, Rabbit monoclonal recombinant, expressed in proprietary host, clone SP36, affinity isolated antibody human (tested)
immunohistochemistry pricing
SAB4502894 Anti-Syntaxin 1A, N-Terminal antibody produced in rabbit affinity isolated antibody mouse, rat, human
immunohistochemistry, western blot pricing
WH0006804M1 Monoclonal Anti-STX1A antibody produced in mouse clone 1F9-1C9, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1404425 Monoclonal Anti-STX1A antibody produced in mouse clone 1B11-1A8, purified immunoglobulin, buffered aqueous solution rat, human
ELISA, immunofluorescence, western blot pricing
S0664 Monoclonal Anti-Syntaxin antibody produced in mouse clone HPC-1, ascites fluid rabbit, bovine, rat
immunocytochemistry, microarray, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004603 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004603 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004603 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_016801 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016801 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016801 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004603 Rosetta Predictions human pricing
NM_053788 Rosetta Predictions rat pricing
NM_016801 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004603 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00197740 predicted 384
2 SASI_Hs02_00337981 predicted 1072
3 SASI_Hs01_00197742 predicted 734
4 SASI_Hs01_00197743 predicted 1054
5 SASI_Hs01_00197744 predicted 735
6 SASI_Hs01_00197745 predicted 1386
7 SASI_Hs01_00197746 predicted 1079
8 SASI_Hs01_00197747 predicted 354
9 SASI_Hs01_00197748 predicted 1382
10 SASI_Hs01_00197749 predicted 244
11 SASI_Hs01_00197741 predicted 898
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053788 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00065142 predicted 779
2 SASI_Rn02_00266594 predicted 838
3 SASI_Rn01_00065144 predicted 385
4 SASI_Rn01_00065145 predicted 620
5 SASI_Rn01_00065146 predicted 1075
6 SASI_Rn01_00065148 predicted 395
7 SASI_Rn01_00065149 predicted 658
8 SASI_Rn01_00065150 predicted 593
9 SASI_Rn01_00065151 predicted 522
10 SASI_Rn02_00266595 predicted 285
11 SASI_Rn01_00065143 predicted 411
12 SASI_Rn01_00065147 predicted 547
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016801 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00022885 predicted 385
2 SASI_Mm01_00022886 predicted 267
3 SASI_Mm01_00022887 predicted 1046
4 SASI_Mm01_00022888 predicted 1076
5 SASI_Mm01_00022890 predicted 1093
6 SASI_Mm01_00022891 predicted 377
7 SASI_Mm01_00022892 predicted 567
8 SASI_Mm01_00022893 predicted 258
9 SASI_Mm01_00022894 predicted 769
10 SASI_Mm02_00323590 predicted 640
11 SASI_Mm01_00022889 predicted 1109
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004603
VALIDATED
STX1A MISSION shRNA Bacterial Glycerol Stock
syntaxin 1A (brain)
Human
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000065008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004603.1-227s1c1
Sequence:CCGGGAAGAACTCATGTCCGACATACTCGAGTATGTCGGACATGAGTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004603.1-372s1c1
Sequence:CCGGCCAGAAAGTTTGTGGAGGTCACTCGAGTGACCTCCACAAACTTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004603.1-695s1c1
Sequence:CCGGAGGATCGAGTACAATGTGGAACTCGAGTTCCACATTGTACTCGATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004603.1-244s1c1
Sequence:CCGGCATAAAGAAGACAGCAAACAACTCGAGTTGTTTGCTGTCTTCTTTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004603.1-113s1c1
Sequence:CCGGGAGGAGATTCGAGGCTTCATTCTCGAGAATGAAGCCTCGAATCTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004603.2-386s21c1
Sequence:GTACCGGACTCCACGCTGTCCAGAAAGTCTCGAGACTTTCTGGACAGCGTGGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004603.2-411s21c1
Sequence:GTACCGGGGAGGTCATGTCGGAGTACAACTCGAGTTGTACTCCGACATGACCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004603.2-555s21c1
Sequence:GTACCGGCTTTGCCTCTGGGATCATCATCTCGAGATGATGATCCCAGAGGCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381347    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004603.2-1075s21c1
Sequence:GTACCGGCTCTGTGAGTGTGCGTCTGTACTCGAGTACAGACGCACACTCACAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380705    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004603.2-1385s21c1
Sequence:GTACCGGTGAGTCTCAGTCGCTGATCACCTCGAGGTGATCAGCGACTGAGACTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_004603.2-255s21c1
Sequence:GTACCGGAGAACTCATGTCCGACATAAACTCGAGTTTATGTCGGACATGAGTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230306    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_004603.2-1631s21c1
Sequence:CCGGCAAGCCAGCGTTGCATGTTTGCTCGAGCAAACATGCAACGCTGGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230305    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_004603.2-716s21c1
Sequence:CCGGTTGACAGGATCGAGTACAATGCTCGAGCATTGTACTCGATCCTGTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257113    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_004603.2-288s21c1
Sequence:CCGGCAAAGTTCGTTCCAAGTTAAACTCGAGTTTAACTTGGAACGAACTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_004603.2-140s21c1
Sequence:CCGGAGGAGATTCGAGGCTTCATTGCTCGAGCAATGAAGCCTCGAATCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004603.2-739s21c1
Sequence:GTACCGGGAACACGCGGTAGACTATGTGCTCGAGCACATAGTCTACCGCGTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004603
VALIDATED
STX1A MISSION shRNA shRNA Plasmid DNA
syntaxin 1A (brain)
Human
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000065008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004603.1-227s1c1
Sequence:CCGGGAAGAACTCATGTCCGACATACTCGAGTATGTCGGACATGAGTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004603.1-372s1c1
Sequence:CCGGCCAGAAAGTTTGTGGAGGTCACTCGAGTGACCTCCACAAACTTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004603.1-695s1c1
Sequence:CCGGAGGATCGAGTACAATGTGGAACTCGAGTTCCACATTGTACTCGATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004603.1-244s1c1
Sequence:CCGGCATAAAGAAGACAGCAAACAACTCGAGTTGTTTGCTGTCTTCTTTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004603.1-113s1c1
Sequence:CCGGGAGGAGATTCGAGGCTTCATTCTCGAGAATGAAGCCTCGAATCTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004603.2-386s21c1
Sequence:GTACCGGACTCCACGCTGTCCAGAAAGTCTCGAGACTTTCTGGACAGCGTGGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004603.2-411s21c1
Sequence:GTACCGGGGAGGTCATGTCGGAGTACAACTCGAGTTGTACTCCGACATGACCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004603.2-555s21c1
Sequence:GTACCGGCTTTGCCTCTGGGATCATCATCTCGAGATGATGATCCCAGAGGCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381347    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004603.2-1075s21c1
Sequence:GTACCGGCTCTGTGAGTGTGCGTCTGTACTCGAGTACAGACGCACACTCACAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380705    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004603.2-1385s21c1
Sequence:GTACCGGTGAGTCTCAGTCGCTGATCACCTCGAGGTGATCAGCGACTGAGACTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_004603.2-255s21c1
Sequence:GTACCGGAGAACTCATGTCCGACATAAACTCGAGTTTATGTCGGACATGAGTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230306    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_004603.2-1631s21c1
Sequence:CCGGCAAGCCAGCGTTGCATGTTTGCTCGAGCAAACATGCAACGCTGGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230305    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_004603.2-716s21c1
Sequence:CCGGTTGACAGGATCGAGTACAATGCTCGAGCATTGTACTCGATCCTGTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257113    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_004603.2-288s21c1
Sequence:CCGGCAAAGTTCGTTCCAAGTTAAACTCGAGTTTAACTTGGAACGAACTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_004603.2-140s21c1
Sequence:CCGGAGGAGATTCGAGGCTTCATTGCTCGAGCAATGAAGCCTCGAATCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004603.2-739s21c1
Sequence:GTACCGGGAACACGCGGTAGACTATGTGCTCGAGCACATAGTCTACCGCGTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004603
VALIDATED
STX1A MISSION shRNA Lentiviral Transduction Particles
syntaxin 1A (brain)
Human
16 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000065008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004603.1-227s1c1
Sequence:CCGGGAAGAACTCATGTCCGACATACTCGAGTATGTCGGACATGAGTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065009    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004603.1-372s1c1
Sequence:CCGGCCAGAAAGTTTGTGGAGGTCACTCGAGTGACCTCCACAAACTTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065011    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004603.1-695s1c1
Sequence:CCGGAGGATCGAGTACAATGTGGAACTCGAGTTCCACATTGTACTCGATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065012    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004603.1-244s1c1
Sequence:CCGGCATAAAGAAGACAGCAAACAACTCGAGTTGTTTGCTGTCTTCTTTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065010    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004603.1-113s1c1
Sequence:CCGGGAGGAGATTCGAGGCTTCATTCTCGAGAATGAAGCCTCGAATCTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004603.2-386s21c1
Sequence:GTACCGGACTCCACGCTGTCCAGAAAGTCTCGAGACTTTCTGGACAGCGTGGAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381844    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004603.2-411s21c1
Sequence:GTACCGGGGAGGTCATGTCGGAGTACAACTCGAGTTGTACTCCGACATGACCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004603.2-555s21c1
Sequence:GTACCGGCTTTGCCTCTGGGATCATCATCTCGAGATGATGATCCCAGAGGCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381347    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004603.2-1075s21c1
Sequence:GTACCGGCTCTGTGAGTGTGCGTCTGTACTCGAGTACAGACGCACACTCACAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380705    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004603.2-1385s21c1
Sequence:GTACCGGTGAGTCTCAGTCGCTGATCACCTCGAGGTGATCAGCGACTGAGACTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 2 Clone ID:NM_004603.2-255s21c1
Sequence:GTACCGGAGAACTCATGTCCGACATAAACTCGAGTTTATGTCGGACATGAGTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230306    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_004603.2-1631s21c1
Sequence:CCGGCAAGCCAGCGTTGCATGTTTGCTCGAGCAAACATGCAACGCTGGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230305    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_004603.2-716s21c1
Sequence:CCGGTTGACAGGATCGAGTACAATGCTCGAGCATTGTACTCGATCCTGTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257113    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_004603.2-288s21c1
Sequence:CCGGCAAAGTTCGTTCCAAGTTAAACTCGAGTTTAACTTGGAACGAACTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_004603.2-140s21c1
Sequence:CCGGAGGAGATTCGAGGCTTCATTGCTCGAGCAATGAAGCCTCGAATCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004603.2-739s21c1
Sequence:GTACCGGGAACACGCGGTAGACTATGTGCTCGAGCACATAGTCTACCGCGTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016801
VALIDATED
STX1A MISSION shRNA Bacterial Glycerol Stock
syntaxin 1A (brain)
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000110580    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016801.2-1363s1c1
Sequence:CCGGGCTCAGCACTGAGTCTTTGTTCTCGAGAACAAAGACTCAGTGCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016801.2-487s1c1
Sequence:CCGGACGACCAGTGAGGAATTGGAACTCGAGTTCCAATTCCTCACTGGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016801.2-277s1c1
Sequence:CCGGCGCTCCAAGCTAAAGAGCATTCTCGAGAATGCTCTTTAGCTTGGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016801.2-693s1c1
Sequence:CCGGGATGATTGACAGGATCGAGTACTCGAGTACTCGATCCTGTCAATCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016801.2-91s1c1
Sequence:CCGGCGCTTCATGGATGAATTCTTTCTCGAGAAAGAATTCATCCATGAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381307    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016801.3-393s21c1
Sequence:GTACCGGGGAGGTCATGTCCGAGTACAACTCGAGTTGTACTCGGACATGACCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016801.3-427s21c1
Sequence:GTACCGGGACTACCGAGAACGCTGCAAACTCGAGTTTGCAGCGTTCTCGGTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016801.3-698s21c1
Sequence:CCGGTTGACAGGATCGAGTACAATGCTCGAGCATTGTACTCGATCCTGTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016801.3-270s21c1
Sequence:CCGGCAAAGTTCGCTCCAAGCTAAACTCGAGTTTAGCTTGGAGCGAACTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236764    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016801.3-1511s21c1
Sequence:CCGGGCCTAGTGACCCTTTACTAAGCTCGAGCTTAGTAAAGGGTCACTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016801.3-237s21c1
Sequence:CCGGGGAGCTCATGTCGGACATTAACTCGAGTTAATGTCCGACATGAGCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236762    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016801.3-484s21c1
Sequence:CCGGACCACGACCAGTGAGGAATTGCTCGAGCAATTCCTCACTGGTCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016801.3-370s21c1
Sequence:GTACCGGTCCACGCTGTCCCGAAAGTTTCTCGAGAAACTTTCGGGACAGCGTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016801
VALIDATED
STX1A MISSION shRNA shRNA Plasmid DNA
syntaxin 1A (brain)
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000110580    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016801.2-1363s1c1
Sequence:CCGGGCTCAGCACTGAGTCTTTGTTCTCGAGAACAAAGACTCAGTGCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016801.2-487s1c1
Sequence:CCGGACGACCAGTGAGGAATTGGAACTCGAGTTCCAATTCCTCACTGGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016801.2-277s1c1
Sequence:CCGGCGCTCCAAGCTAAAGAGCATTCTCGAGAATGCTCTTTAGCTTGGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016801.2-693s1c1
Sequence:CCGGGATGATTGACAGGATCGAGTACTCGAGTACTCGATCCTGTCAATCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016801.2-91s1c1
Sequence:CCGGCGCTTCATGGATGAATTCTTTCTCGAGAAAGAATTCATCCATGAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381307    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016801.3-393s21c1
Sequence:GTACCGGGGAGGTCATGTCCGAGTACAACTCGAGTTGTACTCGGACATGACCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016801.3-427s21c1
Sequence:GTACCGGGACTACCGAGAACGCTGCAAACTCGAGTTTGCAGCGTTCTCGGTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016801.3-698s21c1
Sequence:CCGGTTGACAGGATCGAGTACAATGCTCGAGCATTGTACTCGATCCTGTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016801.3-270s21c1
Sequence:CCGGCAAAGTTCGCTCCAAGCTAAACTCGAGTTTAGCTTGGAGCGAACTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236764    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016801.3-1511s21c1
Sequence:CCGGGCCTAGTGACCCTTTACTAAGCTCGAGCTTAGTAAAGGGTCACTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016801.3-237s21c1
Sequence:CCGGGGAGCTCATGTCGGACATTAACTCGAGTTAATGTCCGACATGAGCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236762    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016801.3-484s21c1
Sequence:CCGGACCACGACCAGTGAGGAATTGCTCGAGCAATTCCTCACTGGTCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016801.3-370s21c1
Sequence:GTACCGGTCCACGCTGTCCCGAAAGTTTCTCGAGAAACTTTCGGGACAGCGTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016801
VALIDATED
STX1A MISSION shRNA Lentiviral Transduction Particles
syntaxin 1A (brain)
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000110580    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016801.2-1363s1c1
Sequence:CCGGGCTCAGCACTGAGTCTTTGTTCTCGAGAACAAAGACTCAGTGCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110584    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016801.2-487s1c1
Sequence:CCGGACGACCAGTGAGGAATTGGAACTCGAGTTCCAATTCCTCACTGGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016801.2-277s1c1
Sequence:CCGGCGCTCCAAGCTAAAGAGCATTCTCGAGAATGCTCTTTAGCTTGGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016801.2-693s1c1
Sequence:CCGGGATGATTGACAGGATCGAGTACTCGAGTACTCGATCCTGTCAATCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110582    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016801.2-91s1c1
Sequence:CCGGCGCTTCATGGATGAATTCTTTCTCGAGAAAGAATTCATCCATGAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381307    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016801.3-393s21c1
Sequence:GTACCGGGGAGGTCATGTCCGAGTACAACTCGAGTTGTACTCGGACATGACCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016801.3-427s21c1
Sequence:GTACCGGGACTACCGAGAACGCTGCAAACTCGAGTTTGCAGCGTTCTCGGTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016801.3-698s21c1
Sequence:CCGGTTGACAGGATCGAGTACAATGCTCGAGCATTGTACTCGATCCTGTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016801.3-270s21c1
Sequence:CCGGCAAAGTTCGCTCCAAGCTAAACTCGAGTTTAGCTTGGAGCGAACTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236764    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016801.3-1511s21c1
Sequence:CCGGGCCTAGTGACCCTTTACTAAGCTCGAGCTTAGTAAAGGGTCACTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236763    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016801.3-237s21c1
Sequence:CCGGGGAGCTCATGTCGGACATTAACTCGAGTTAATGTCCGACATGAGCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236762    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_016801.3-484s21c1
Sequence:CCGGACCACGACCAGTGAGGAATTGCTCGAGCAATTCCTCACTGGTCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380092    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016801.3-370s21c1
Sequence:GTACCGGTCCACGCTGTCCCGAAAGTTTCTCGAGAAACTTTCGGGACAGCGTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks