EMAIL THIS PAGE TO A FRIEND

STX1B

syntaxin 1B

Synonyms: STX1B1 STX1B2
UniProtKB ID: P61266, Q15531
Gene ID:
Human(112755) Summary: Syntaxins are cellular receptors for transport vesicles (see MIM 603765). One of these proteins, designated syntaxin 1B (STX1B), is directly implicated in the process of calcium-dependent synaptic transmission in rat brain (Smirnova et al., 1993 [PubMed 8105537]
Mouse(56216) syntaxin 1B
Rat(24923) syntaxin 1B
Zebrafish(58038) syntaxin 1B
chicken(395957) syntaxin1B
dog(489918) syntaxin 1B
cow(282377) syntaxin 1B
sheep(443479) syntaxin 1B
105 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1103009 Anti-STX1B (16-30) antibody produced in rabbit IgG fraction of antiserum human
western blot pricing
S1172 Anti-Syntaxin 1 antibody produced in rabbit IgG fraction of antiserum, lyophilized powder rat, mouse
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_052874 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_052874 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_052874 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_024414 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_024414 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_024414 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_052874 Rosetta Predictions human pricing
NM_012700 Rosetta Predictions rat pricing
NM_024414 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_052874 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00179360 predicted 1449
2 SASI_Hs01_00179361 predicted 360
3 SASI_Hs01_00179362 predicted 372
4 SASI_Hs02_00361582 predicted 362
5 SASI_Hs01_00179363 predicted 492
6 SASI_Hs02_00361583 predicted 490
7 SASI_Hs01_00179364 predicted 671
8 SASI_Hs01_00179366 predicted 687
9 SASI_Hs01_00179368 predicted 743
10 SASI_Hs01_00179369 predicted 473
11 SASI_Hs01_00179365 predicted 634
12 SASI_Hs01_00179367 predicted 1396
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012700 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00084815 predicted 309
2 SASI_Rn01_00084816 predicted 506
3 SASI_Rn01_00084817 predicted 800
4 SASI_Rn01_00084820 predicted 619
5 SASI_Rn01_00084822 predicted 426
6 SASI_Rn02_00260012 predicted 430
7 SASI_Rn02_00260013 predicted 793
8 SASI_Rn01_00084823 predicted 397
9 SASI_Rn01_00084824 predicted 517
10 SASI_Rn02_00260014 predicted 300
11 SASI_Rn01_00084818 predicted 279
12 SASI_Rn01_00084819 predicted 1256
13 SASI_Rn01_00084821 predicted 251
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024414 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00327729 predicted 307
2 SASI_Mm02_00327730 predicted 308
3 SASI_Mm01_00025452 predicted 697
4 SASI_Mm01_00025454 predicted 613
5 SASI_Mm02_00327731 predicted 1256
6 SASI_Mm01_00025456 predicted 701
7 SASI_Mm02_00327732 predicted 982
8 SASI_Mm01_00025457 predicted 593
9 SASI_Mm01_00025458 predicted 491
10 SASI_Mm02_00327733 predicted 1216
11 SASI_Mm01_00025450 predicted 741
12 SASI_Mm01_00025451 predicted 541
13 SASI_Mm01_00025453 predicted 772
14 SASI_Mm01_00025455 predicted 450
15 SASI_Mm01_00025459 predicted 641
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_052874
STX1B MISSION shRNA Bacterial Glycerol Stock
syntaxin 1B
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000442825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052874.3-581s21c1
Sequence:CCGGAGGACCACCACCAACGAAGAACTCGAGTTCTTCGTTGGTGGTGGTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052874.3-939s21c1
Sequence:CCGGTGGTCTTGGCGTCATCCATTGCTCGAGCAATGGATGACGCCAAGACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422442    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052874.3-1355s21c1
Sequence:CCGGTAGACTGCAGCCAAGTGTAACCTCGAGGTTACACTTGGCTGCAGTCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052874.1-311s1c1
Sequence:CCGGGCCAACAAGGTTCGGTCCAAACTCGAGTTTGGACCGAACCTTGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052874.1-804s1c1
Sequence:CCGGACACCAAGAAAGCAGTGAAATCTCGAGATTTCACTGCTTTCTTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052874.1-89s1c1
Sequence:CCGGGCGAAAGACAGTGATGATGAACTCGAGTTCATCATCACTGTCTTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052874.1-691s1c1
Sequence:CCGGGCACGATATGTTTGTGGACATCTCGAGATGTCCACAAACATATCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052874.1-436s1c1
Sequence:CCGGCGTGGAGGTAATGACCGAATACTCGAGTATTCGGTCATTACCTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_052874
STX1B MISSION shRNA shRNA Plasmid DNA
syntaxin 1B
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000442825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052874.3-581s21c1
Sequence:CCGGAGGACCACCACCAACGAAGAACTCGAGTTCTTCGTTGGTGGTGGTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052874.3-939s21c1
Sequence:CCGGTGGTCTTGGCGTCATCCATTGCTCGAGCAATGGATGACGCCAAGACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422442    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052874.3-1355s21c1
Sequence:CCGGTAGACTGCAGCCAAGTGTAACCTCGAGGTTACACTTGGCTGCAGTCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052874.1-311s1c1
Sequence:CCGGGCCAACAAGGTTCGGTCCAAACTCGAGTTTGGACCGAACCTTGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052874.1-804s1c1
Sequence:CCGGACACCAAGAAAGCAGTGAAATCTCGAGATTTCACTGCTTTCTTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052874.1-89s1c1
Sequence:CCGGGCGAAAGACAGTGATGATGAACTCGAGTTCATCATCACTGTCTTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052874.1-691s1c1
Sequence:CCGGGCACGATATGTTTGTGGACATCTCGAGATGTCCACAAACATATCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052874.1-436s1c1
Sequence:CCGGCGTGGAGGTAATGACCGAATACTCGAGTATTCGGTCATTACCTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_052874
STX1B MISSION shRNA Lentiviral Transduction Particles
syntaxin 1B
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000442825    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052874.3-581s21c1
Sequence:CCGGAGGACCACCACCAACGAAGAACTCGAGTTCTTCGTTGGTGGTGGTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052874.3-939s21c1
Sequence:CCGGTGGTCTTGGCGTCATCCATTGCTCGAGCAATGGATGACGCCAAGACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422442    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052874.3-1355s21c1
Sequence:CCGGTAGACTGCAGCCAAGTGTAACCTCGAGGTTACACTTGGCTGCAGTCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052874.1-311s1c1
Sequence:CCGGGCCAACAAGGTTCGGTCCAAACTCGAGTTTGGACCGAACCTTGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065266    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052874.1-804s1c1
Sequence:CCGGACACCAAGAAAGCAGTGAAATCTCGAGATTTCACTGCTTTCTTGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065265    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052874.1-89s1c1
Sequence:CCGGGCGAAAGACAGTGATGATGAACTCGAGTTCATCATCACTGTCTTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065263    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052874.1-691s1c1
Sequence:CCGGGCACGATATGTTTGTGGACATCTCGAGATGTCCACAAACATATCGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065264    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052874.1-436s1c1
Sequence:CCGGCGTGGAGGTAATGACCGAATACTCGAGTATTCGGTCATTACCTCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024414
STX1B MISSION shRNA Bacterial Glycerol Stock
syntaxin 1B
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000110495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024414.1-448s1c1
Sequence:CCGGGTGGAGGTAATGACCGAATATCTCGAGATATTCGGTCATTACCTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024414.1-756s1c1
Sequence:CCGGCGACCGAATTGAGTACAACGTCTCGAGACGTTGTACTCAATTCGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024414.1-544s1c1
Sequence:CCGGACTACCAATGAAGAACTAGAACTCGAGTTCTAGTTCTTCATTGGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024414.1-760s1c1
Sequence:CCGGCGAATTGAGTACAACGTGGAACTCGAGTTCCACGTTGTACTCAATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024414.1-658s1c1
Sequence:CCGGAGGCACAATGAGATCATCAAACTCGAGTTTGATGATCTCATTGTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024414
STX1B MISSION shRNA shRNA Plasmid DNA
syntaxin 1B
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000110495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024414.1-448s1c1
Sequence:CCGGGTGGAGGTAATGACCGAATATCTCGAGATATTCGGTCATTACCTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024414.1-756s1c1
Sequence:CCGGCGACCGAATTGAGTACAACGTCTCGAGACGTTGTACTCAATTCGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024414.1-544s1c1
Sequence:CCGGACTACCAATGAAGAACTAGAACTCGAGTTCTAGTTCTTCATTGGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024414.1-760s1c1
Sequence:CCGGCGAATTGAGTACAACGTGGAACTCGAGTTCCACGTTGTACTCAATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024414.1-658s1c1
Sequence:CCGGAGGCACAATGAGATCATCAAACTCGAGTTTGATGATCTCATTGTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024414
STX1B MISSION shRNA Lentiviral Transduction Particles
syntaxin 1B
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000110495    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024414.1-448s1c1
Sequence:CCGGGTGGAGGTAATGACCGAATATCTCGAGATATTCGGTCATTACCTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110498    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024414.1-756s1c1
Sequence:CCGGCGACCGAATTGAGTACAACGTCTCGAGACGTTGTACTCAATTCGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024414.1-544s1c1
Sequence:CCGGACTACCAATGAAGAACTAGAACTCGAGTTCTAGTTCTTCATTGGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110496    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024414.1-760s1c1
Sequence:CCGGCGAATTGAGTACAACGTGGAACTCGAGTTCCACGTTGTACTCAATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110497    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024414.1-658s1c1
Sequence:CCGGAGGCACAATGAGATCATCAAACTCGAGTTTGATGATCTCATTGTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks