EMAIL THIS PAGE TO A FRIEND

STX2

syntaxin 2

Synonyms: EPIM EPM STX2A STX2B STX2C
UniProtKB ID: P32856, Q86VW8
Gene ID:
Human(2054) Summary: The product of this gene belongs to the syntaxin/epimorphin family of proteins. The syntaxins are a large protein family implicated in the targeting and fusion of intracellular transport vesicles. The product of this gene regulates epithelial-mesenchymal interactions and epithelial cell morphogenesis and activation. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
Mouse(13852) syntaxin 2
Rat(25130) syntaxin 2
cow(519148) syntaxin 2
sheep(101118731) syntaxin 2
chicken(378895) syntaxin 2
Horse(100062798) syntaxin 2
dog(477439) syntaxin 2
91 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001980 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001980 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001980 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007941 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007941 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007941 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001980 Rosetta Predictions human pricing
NM_194356 Rosetta Predictions human pricing
NM_012748 Rosetta Predictions rat pricing
NM_007941 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001980 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00237395 predicted 634
2 SASI_Hs02_00332961 predicted 637
3 SASI_Hs02_00332962 predicted 492
4 SASI_Hs01_00237396 predicted 726
5 SASI_Hs01_00237397 predicted 430
6 SASI_Hs01_00237398 predicted 546
7 SASI_Hs01_00237399 predicted 573
8 SASI_Hs01_00237400 predicted 428
9 SASI_Hs01_00237402 predicted 534
10 SASI_Hs01_00237404 predicted 725
11 SASI_Hs01_00237401 predicted 432
12 SASI_Hs01_00237403 predicted 626
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_194356 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00011428 predicted 641
2 SASI_Hs02_00371490 predicted 642
3 SASI_Hs02_00371491 predicted 488
4 SASI_Hs01_00011429 predicted 725
5 SASI_Hs01_00011430 predicted 434
6 SASI_Hs01_00011431 predicted 541
7 SASI_Hs01_00011432 predicted 565
8 SASI_Hs01_00011433 predicted 430
9 SASI_Hs01_00011435 predicted 530
10 SASI_Hs01_00011437 predicted 720
11 SASI_Hs01_00011434 predicted 434
12 SASI_Hs01_00011436 predicted 628
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012748 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00055414 predicted 385
2 SASI_Rn02_00260104 predicted 660
3 SASI_Rn01_00055416 predicted 574
4 SASI_Rn01_00055417 predicted 439
5 SASI_Rn01_00055418 predicted 351
6 SASI_Rn01_00055420 predicted 378
7 SASI_Rn01_00055421 predicted 300
8 SASI_Rn02_00260105 predicted 226
9 SASI_Rn01_00055422 predicted 373
10 SASI_Rn01_00055423 predicted 409
11 SASI_Rn01_00055415 predicted 644
12 SASI_Rn01_00055419 predicted 338
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007941 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00130162 predicted 514
2 SASI_Mm02_00312786 predicted 662
3 SASI_Mm01_00130164 predicted 271
4 SASI_Mm01_00130165 predicted 796
5 SASI_Mm01_00130166 predicted 1083
6 SASI_Mm01_00130167 predicted 1053
7 SASI_Mm01_00130168 predicted 420
8 SASI_Mm01_00130169 predicted 1078
9 SASI_Mm01_00130170 predicted 510
10 SASI_Mm01_00130171 predicted 1069
11 SASI_Mm01_00130163 predicted 858
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001980
STX2 MISSION shRNA Bacterial Glycerol Stock
syntaxin 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000065283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001980.2-432s1c1
Sequence:CCGGCGAGCCAAGTTAAAGGCTATTCTCGAGAATAGCCTTTAACTTGGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001980.2-1010s1c1
Sequence:CCGGCCTAGCAACAACATTGTCCTACTCGAGTAGGACAATGTTGTTGCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001980.2-688s1c1
Sequence:CCGGCCATCTTCACTTCCGACATTACTCGAGTAATGTCGGAAGTGAAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001980.2-800s1c1
Sequence:CCGGGCATGAGATGTTCATGGACATCTCGAGATGTCCATGAACATCTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001980.2-195s1c1
Sequence:CCGGGCGTGTAGGAAGAATGATGATCTCGAGATCATCATTCTTCCTACACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000382503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001980.2-888s21c1
Sequence:GTACCGGGACTATGTAGAACACGCTAAACTCGAGTTTAGCGTGTTCTACATAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380917    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001980.2-1110s21c1
Sequence:GTACCGGATGAATCTCAGACGCTGTAACCTCGAGGTTACAGCGTCTGAGATTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380612    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001980.2-1036s21c1
Sequence:GTACCGGCATATCCCAAGAGCCATTTATCTCGAGATAAATGGCTCTTGGGATATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001980
STX2 MISSION shRNA shRNA Plasmid DNA
syntaxin 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000065283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001980.2-432s1c1
Sequence:CCGGCGAGCCAAGTTAAAGGCTATTCTCGAGAATAGCCTTTAACTTGGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001980.2-1010s1c1
Sequence:CCGGCCTAGCAACAACATTGTCCTACTCGAGTAGGACAATGTTGTTGCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001980.2-688s1c1
Sequence:CCGGCCATCTTCACTTCCGACATTACTCGAGTAATGTCGGAAGTGAAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001980.2-800s1c1
Sequence:CCGGGCATGAGATGTTCATGGACATCTCGAGATGTCCATGAACATCTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001980.2-195s1c1
Sequence:CCGGGCGTGTAGGAAGAATGATGATCTCGAGATCATCATTCTTCCTACACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000382503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001980.2-888s21c1
Sequence:GTACCGGGACTATGTAGAACACGCTAAACTCGAGTTTAGCGTGTTCTACATAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380917    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001980.2-1110s21c1
Sequence:GTACCGGATGAATCTCAGACGCTGTAACCTCGAGGTTACAGCGTCTGAGATTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380612    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001980.2-1036s21c1
Sequence:GTACCGGCATATCCCAAGAGCCATTTATCTCGAGATAAATGGCTCTTGGGATATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001980
STX2 MISSION shRNA Lentiviral Transduction Particles
syntaxin 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000065283    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001980.2-432s1c1
Sequence:CCGGCGAGCCAAGTTAAAGGCTATTCTCGAGAATAGCCTTTAACTTGGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065284    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001980.2-1010s1c1
Sequence:CCGGCCTAGCAACAACATTGTCCTACTCGAGTAGGACAATGTTGTTGCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001980.2-688s1c1
Sequence:CCGGCCATCTTCACTTCCGACATTACTCGAGTAATGTCGGAAGTGAAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065287    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001980.2-800s1c1
Sequence:CCGGGCATGAGATGTTCATGGACATCTCGAGATGTCCATGAACATCTCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065285    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001980.2-195s1c1
Sequence:CCGGGCGTGTAGGAAGAATGATGATCTCGAGATCATCATTCTTCCTACACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000382503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001980.2-888s21c1
Sequence:GTACCGGGACTATGTAGAACACGCTAAACTCGAGTTTAGCGTGTTCTACATAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380917    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001980.2-1110s21c1
Sequence:GTACCGGATGAATCTCAGACGCTGTAACCTCGAGGTTACAGCGTCTGAGATTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380612    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001980.2-1036s21c1
Sequence:GTACCGGCATATCCCAAGAGCCATTTATCTCGAGATAAATGGCTCTTGGGATATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007941
VALIDATED
STX2 MISSION shRNA Bacterial Glycerol Stock
syntaxin 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000110600    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007941.1-2066s1c1
Sequence:CCGGCGACCAAGTATGTGAAGGATACTCGAGTATCCTTCACATACTTGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110602    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007941.1-840s1c1
Sequence:CCGGGTCAACAACATCGAGAGAAATCTCGAGATTTCTCTCGATGTTGTTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110604    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007941.1-435s1c1
Sequence:CCGGTCTATTGAGCAGAGCTGTGATCTCGAGATCACAGCTCTGCTCAATAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007941.1-243s1c1
Sequence:CCGGGACGGTTTCTTCCATCAGGTACTCGAGTACCTGATGGAAGAAACCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007941.1-986s1c1
Sequence:CCGGCCTGGCTCTAATCATTGGCTTCTCGAGAAGCCAATGATTAGAGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312194    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007941.2-424s21c1
Sequence:CCGGTCTATTGAGCAGAGCTGTGATCTCGAGATCACAGCTCTGCTCAATAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312195    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007941.2-829s21c1
Sequence:CCGGGTCAACAACATCGAGAGAAATCTCGAGATTTCTCTCGATGTTGTTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349428    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007941.2-2055s21c1
Sequence:CCGGCGACCAAGTATGTGAAGGATACTCGAGTATCCTTCACATACTTGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007941.2-665s21c1
Sequence:CCGGCCATCTTCATCTCGGATATTACTCGAGTAATATCCGAGATGAAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000313247    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007941.2-807s21c1
Sequence:CCGGTGTCGAGACTCAGGGTGAAATCTCGAGATTTCACCCTGAGTCTCGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007941
VALIDATED
STX2 MISSION shRNA shRNA Plasmid DNA
syntaxin 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000110600    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007941.1-2066s1c1
Sequence:CCGGCGACCAAGTATGTGAAGGATACTCGAGTATCCTTCACATACTTGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110602    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007941.1-840s1c1
Sequence:CCGGGTCAACAACATCGAGAGAAATCTCGAGATTTCTCTCGATGTTGTTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110604    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007941.1-435s1c1
Sequence:CCGGTCTATTGAGCAGAGCTGTGATCTCGAGATCACAGCTCTGCTCAATAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007941.1-243s1c1
Sequence:CCGGGACGGTTTCTTCCATCAGGTACTCGAGTACCTGATGGAAGAAACCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007941.1-986s1c1
Sequence:CCGGCCTGGCTCTAATCATTGGCTTCTCGAGAAGCCAATGATTAGAGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312194    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007941.2-424s21c1
Sequence:CCGGTCTATTGAGCAGAGCTGTGATCTCGAGATCACAGCTCTGCTCAATAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312195    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007941.2-829s21c1
Sequence:CCGGGTCAACAACATCGAGAGAAATCTCGAGATTTCTCTCGATGTTGTTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349428    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007941.2-2055s21c1
Sequence:CCGGCGACCAAGTATGTGAAGGATACTCGAGTATCCTTCACATACTTGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007941.2-665s21c1
Sequence:CCGGCCATCTTCATCTCGGATATTACTCGAGTAATATCCGAGATGAAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000313247    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007941.2-807s21c1
Sequence:CCGGTGTCGAGACTCAGGGTGAAATCTCGAGATTTCACCCTGAGTCTCGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007941
VALIDATED
STX2 MISSION shRNA Lentiviral Transduction Particles
syntaxin 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000110600    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007941.1-2066s1c1
Sequence:CCGGCGACCAAGTATGTGAAGGATACTCGAGTATCCTTCACATACTTGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110602    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007941.1-840s1c1
Sequence:CCGGGTCAACAACATCGAGAGAAATCTCGAGATTTCTCTCGATGTTGTTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110604    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007941.1-435s1c1
Sequence:CCGGTCTATTGAGCAGAGCTGTGATCTCGAGATCACAGCTCTGCTCAATAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007941.1-243s1c1
Sequence:CCGGGACGGTTTCTTCCATCAGGTACTCGAGTACCTGATGGAAGAAACCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007941.1-986s1c1
Sequence:CCGGCCTGGCTCTAATCATTGGCTTCTCGAGAAGCCAATGATTAGAGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312194    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007941.2-424s21c1
Sequence:CCGGTCTATTGAGCAGAGCTGTGATCTCGAGATCACAGCTCTGCTCAATAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312195    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007941.2-829s21c1
Sequence:CCGGGTCAACAACATCGAGAGAAATCTCGAGATTTCTCTCGATGTTGTTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349428    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007941.2-2055s21c1
Sequence:CCGGCGACCAAGTATGTGAAGGATACTCGAGTATCCTTCACATACTTGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007941.2-665s21c1
Sequence:CCGGCCATCTTCATCTCGGATATTACTCGAGTAATATCCGAGATGAAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000313247    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007941.2-807s21c1
Sequence:CCGGTGTCGAGACTCAGGGTGAAATCTCGAGATTTCACCCTGAGTCTCGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks