EMAIL THIS PAGE TO A FRIEND

STX3

syntaxin 3

Synonyms: STX3A
UniProtKB ID: Q13277, B4DME0, O43750, O43751, Q15360
Gene ID:
Human(6809) Summary: The gene is a member of the syntaxin family. The encoded protein is targeted to the apical membrane of epithelial cells where it forms clusters and is important in establishing and maintaining polarity necessary for protein trafficking involving vesicle fusion and exocytosis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2010]
Mouse(20908) syntaxin 3
Rat(81802) syntaxin 3
chicken(428839) syntaxin 3
cow(513275) syntaxin 3
sheep(101113435) syntaxin 3
73 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0897 AQUA Peptide YNEAQVDF[R] human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004177 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004177 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004177 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001025307 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001025307 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001025307 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU093791 MISSION® esiRNA esiRNA human STX3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004177 Rosetta Predictions human pricing
NM_031124 Rosetta Predictions rat pricing
NM_001025307 Rosetta Predictions mouse pricing
NM_011502 Rosetta Predictions mouse pricing
NM_152220 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004177 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00337058 predicted 458
2 SASI_Hs01_00208484 predicted 764
3 SASI_Hs01_00208485 predicted 309
4 SASI_Hs02_00337059 predicted 561
5 SASI_Hs01_00208486 predicted 632
6 SASI_Hs01_00208487 predicted 446
7 SASI_Hs01_00208488 predicted 852
8 SASI_Hs01_00208489 predicted 805
9 SASI_Hs01_00208490 predicted 326
10 SASI_Hs01_00208491 predicted 353
11 SASI_Hs01_00208492 predicted 379
12 SASI_Hs01_00208493 predicted 692
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031124 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00094686 predicted 343
2 SASI_Rn01_00094687 predicted 333
3 SASI_Rn01_00094688 predicted 442
4 SASI_Rn01_00094689 predicted 750
5 SASI_Rn01_00094690 predicted 694
6 SASI_Rn01_00094691 predicted 606
7 SASI_Rn01_00094692 predicted 646
8 SASI_Rn01_00094694 predicted 266
9 SASI_Rn02_00264436 predicted 707
10 SASI_Rn02_00264437 predicted 561
11 SASI_Rn01_00094693 predicted 315
12 SASI_Rn01_00094695 predicted 310
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025307 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00093121 predicted 1921
2 SASI_Mm01_00093122 predicted 1301
3 SASI_Mm01_00093123 predicted 1660
4 SASI_Mm01_00093124 predicted 1256
5 SASI_Mm01_00093125 predicted 1307
6 SASI_Mm01_00093126 predicted 1484
7 SASI_Mm01_00093127 predicted 1743
8 SASI_Mm01_00093128 predicted 1749
9 SASI_Mm01_00093129 predicted 1658
10 SASI_Mm01_00093130 predicted 1630
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011502 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00137649 predicted 1362
2 SASI_Mm01_00137650 predicted 734
3 SASI_Mm01_00137651 predicted 1094
4 SASI_Mm01_00137652 predicted 693
5 SASI_Mm01_00137653 predicted 750
6 SASI_Mm01_00137654 predicted 923
7 SASI_Mm01_00137655 predicted 1180
8 SASI_Mm01_00137656 predicted 1183
9 SASI_Mm01_00137657 predicted 1102
10 SASI_Mm01_00137658 predicted 1069
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152220 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00148340 predicted 936
2 SASI_Mm02_00342794 predicted 793
3 SASI_Mm01_00148341 predicted 1059
4 SASI_Mm01_00148342 predicted 1051
5 SASI_Mm01_00148343 predicted 801
6 SASI_Mm01_00148344 predicted 1121
7 SASI_Mm01_00148345 predicted 1012
8 SASI_Mm01_00148347 predicted 846
9 SASI_Mm01_00148348 predicted 983
10 SASI_Mm01_00148349 predicted 819
11 SASI_Mm01_00148346 predicted 909
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004177
VALIDATED
STX3 MISSION shRNA Bacterial Glycerol Stock
syntaxin 3
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000382342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_004177.3-1041s21c1
Sequence:GTACCGGTTTCCGTTGGGCTGAATTAAGCTCGAGCTTAATTCAGCCCAACGGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_004177.3-522s21c1
Sequence:GTACCGGCAGACCTTCGGATTCGGAAATCTCGAGATTTCCGAATCCGAAGGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004177.3-424s21c1
Sequence:CCGGGCAGCTCACGACTGAGATTAACTCGAGTTAATCTCAGTCGTGAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303420    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004177.3-1209s21c1
Sequence:CCGGGACCTGACTCAGCTAACAATCCTCGAGGATTGTTAGCTGAGTCAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303419    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_004177.3-477s21c1
Sequence:CCGGAGAGCATGGAGAAGCATATTGCTCGAGCAATATGCTTCTCCATGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000310355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004177.3-968s21c1
Sequence:CCGGGCCCGGAAGAAATTGATAATTCTCGAGAATTATCAATTTCTTCCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000310352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004177.3-304s21c1
Sequence:CCGGGATTGAGGAAACTCGGCTTAACTCGAGTTAAGCCGAGTTTCCTCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004177.3-968s1c1
Sequence:CCGGGCCCGGAAGAAATTGATAATTCTCGAGAATTATCAATTTCTTCCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065014    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_004177.3-424s1c1
Sequence:CCGGGCAGCTCACGACTGAGATTAACTCGAGTTAATCTCAGTCGTGAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004177.3-304s1c1
Sequence:CCGGGATTGAGGAAACTCGGCTTAACTCGAGTTAAGCCGAGTTTCCTCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004177.3-643s1c1
Sequence:CCGGGCAGCTCGAAATTACTGGCAACTCGAGTTGCCAGTAATTTCGAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004177
VALIDATED
STX3 MISSION shRNA shRNA Plasmid DNA
syntaxin 3
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000382342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_004177.3-1041s21c1
Sequence:GTACCGGTTTCCGTTGGGCTGAATTAAGCTCGAGCTTAATTCAGCCCAACGGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_004177.3-522s21c1
Sequence:GTACCGGCAGACCTTCGGATTCGGAAATCTCGAGATTTCCGAATCCGAAGGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004177.3-424s21c1
Sequence:CCGGGCAGCTCACGACTGAGATTAACTCGAGTTAATCTCAGTCGTGAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303420    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004177.3-1209s21c1
Sequence:CCGGGACCTGACTCAGCTAACAATCCTCGAGGATTGTTAGCTGAGTCAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303419    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_004177.3-477s21c1
Sequence:CCGGAGAGCATGGAGAAGCATATTGCTCGAGCAATATGCTTCTCCATGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000310355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004177.3-968s21c1
Sequence:CCGGGCCCGGAAGAAATTGATAATTCTCGAGAATTATCAATTTCTTCCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000310352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004177.3-304s21c1
Sequence:CCGGGATTGAGGAAACTCGGCTTAACTCGAGTTAAGCCGAGTTTCCTCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004177.3-968s1c1
Sequence:CCGGGCCCGGAAGAAATTGATAATTCTCGAGAATTATCAATTTCTTCCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065014    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_004177.3-424s1c1
Sequence:CCGGGCAGCTCACGACTGAGATTAACTCGAGTTAATCTCAGTCGTGAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004177.3-304s1c1
Sequence:CCGGGATTGAGGAAACTCGGCTTAACTCGAGTTAAGCCGAGTTTCCTCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004177.3-643s1c1
Sequence:CCGGGCAGCTCGAAATTACTGGCAACTCGAGTTGCCAGTAATTTCGAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004177
VALIDATED
STX3 MISSION shRNA Lentiviral Transduction Particles
syntaxin 3
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000382342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_004177.3-1041s21c1
Sequence:GTACCGGTTTCCGTTGGGCTGAATTAAGCTCGAGCTTAATTCAGCCCAACGGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379420    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 2 Clone ID:NM_004177.3-522s21c1
Sequence:GTACCGGCAGACCTTCGGATTCGGAAATCTCGAGATTTCCGAATCCGAAGGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299058    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004177.3-424s21c1
Sequence:CCGGGCAGCTCACGACTGAGATTAACTCGAGTTAATCTCAGTCGTGAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303420    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004177.3-1209s21c1
Sequence:CCGGGACCTGACTCAGCTAACAATCCTCGAGGATTGTTAGCTGAGTCAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303419    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_004177.3-477s21c1
Sequence:CCGGAGAGCATGGAGAAGCATATTGCTCGAGCAATATGCTTCTCCATGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000310355    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004177.3-968s21c1
Sequence:CCGGGCCCGGAAGAAATTGATAATTCTCGAGAATTATCAATTTCTTCCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000310352    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004177.3-304s21c1
Sequence:CCGGGATTGAGGAAACTCGGCTTAACTCGAGTTAAGCCGAGTTTCCTCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065013    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004177.3-968s1c1
Sequence:CCGGGCCCGGAAGAAATTGATAATTCTCGAGAATTATCAATTTCTTCCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065014    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_004177.3-424s1c1
Sequence:CCGGGCAGCTCACGACTGAGATTAACTCGAGTTAATCTCAGTCGTGAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065016    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004177.3-304s1c1
Sequence:CCGGGATTGAGGAAACTCGGCTTAACTCGAGTTAAGCCGAGTTTCCTCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065015    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004177.3-643s1c1
Sequence:CCGGGCAGCTCGAAATTACTGGCAACTCGAGTTGCCAGTAATTTCGAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001025307
STX3 MISSION shRNA Bacterial Glycerol Stock
syntaxin 3
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000340167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025307.1-1209s21c1
Sequence:CCGGTCTTCACTTCTGGGATCATTGCTCGAGCAATGATCCCAGAAGTGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025307.1-801s21c1
Sequence:CCGGAGGAAACACGGCTCAACATTGCTCGAGCAATGTTGAGCCGTGTTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025307.1-1480s21c1
Sequence:CCGGGATCATGATCTGCTGTATTATCTCGAGATAATACAGCAGATCATGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340238    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001025307.1-1729s21c1
Sequence:CCGGGAACAGGGAGCACGGCAATATCTCGAGATATTGCCGTGCTCCCTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000351114    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025307.1-1126s21c1
Sequence:CCGGCATCCAACGGCAGCTTGAAATCTCGAGATTTCAAGCTGCCGTTGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380739    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025307.1-1068s21c1
Sequence:GTACCGGAGGTGATGACAAAGTACAATGCTCGAGCATTGTACTTTGTCATCACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381656    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001025307.1-1801s21c1
Sequence:GTACCGGTAACGAACGGGTCCCTGTTTACTCGAGTAAACAGGGACCCGTTCGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025307.1-735s21c1
Sequence:GTACCGGACACGGACGAGGTTGAGATTGCTCGAGCAATCTCAACCTCGTCCGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110510    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001025307.1-1660s1c1
Sequence:CCGGGCACCAATCAACTGTTTATTACTCGAGTAATAAACAGTTGATTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025307.1-1138s1c1
Sequence:CCGGGCTTGAAATTACTGGCAAGAACTCGAGTTCTTGCCAGTAATTTCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025307.1-740s1c1
Sequence:CCGGGACGAGGTTGAGATTGCCATTCTCGAGAATGGCAATCTCAACCTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025307.1-1489s1c1
Sequence:CCGGCTGCTGTATTATCCTTGCCATCTCGAGATGGCAAGGATAATACAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000110511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025307.1-1439s1c1
Sequence:CCGGGCGGTCAAGTATCAGAGTGAACTCGAGTTCACTCTGATACTTGACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001025307
STX3 MISSION shRNA shRNA Plasmid DNA
syntaxin 3
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000340167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025307.1-1209s21c1
Sequence:CCGGTCTTCACTTCTGGGATCATTGCTCGAGCAATGATCCCAGAAGTGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025307.1-801s21c1
Sequence:CCGGAGGAAACACGGCTCAACATTGCTCGAGCAATGTTGAGCCGTGTTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025307.1-1480s21c1
Sequence:CCGGGATCATGATCTGCTGTATTATCTCGAGATAATACAGCAGATCATGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340238    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001025307.1-1729s21c1
Sequence:CCGGGAACAGGGAGCACGGCAATATCTCGAGATATTGCCGTGCTCCCTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000351114    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025307.1-1126s21c1
Sequence:CCGGCATCCAACGGCAGCTTGAAATCTCGAGATTTCAAGCTGCCGTTGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380739    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025307.1-1068s21c1
Sequence:GTACCGGAGGTGATGACAAAGTACAATGCTCGAGCATTGTACTTTGTCATCACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381656    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001025307.1-1801s21c1
Sequence:GTACCGGTAACGAACGGGTCCCTGTTTACTCGAGTAAACAGGGACCCGTTCGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025307.1-735s21c1
Sequence:GTACCGGACACGGACGAGGTTGAGATTGCTCGAGCAATCTCAACCTCGTCCGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110510    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001025307.1-1660s1c1
Sequence:CCGGGCACCAATCAACTGTTTATTACTCGAGTAATAAACAGTTGATTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025307.1-1138s1c1
Sequence:CCGGGCTTGAAATTACTGGCAAGAACTCGAGTTCTTGCCAGTAATTTCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025307.1-740s1c1
Sequence:CCGGGACGAGGTTGAGATTGCCATTCTCGAGAATGGCAATCTCAACCTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025307.1-1489s1c1
Sequence:CCGGCTGCTGTATTATCCTTGCCATCTCGAGATGGCAAGGATAATACAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000110511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025307.1-1439s1c1
Sequence:CCGGGCGGTCAAGTATCAGAGTGAACTCGAGTTCACTCTGATACTTGACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001025307
STX3 MISSION shRNA Lentiviral Transduction Particles
syntaxin 3
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000340167    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025307.1-1209s21c1
Sequence:CCGGTCTTCACTTCTGGGATCATTGCTCGAGCAATGATCCCAGAAGTGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340240    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025307.1-801s21c1
Sequence:CCGGAGGAAACACGGCTCAACATTGCTCGAGCAATGTTGAGCCGTGTTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340239    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025307.1-1480s21c1
Sequence:CCGGGATCATGATCTGCTGTATTATCTCGAGATAATACAGCAGATCATGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340238    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001025307.1-1729s21c1
Sequence:CCGGGAACAGGGAGCACGGCAATATCTCGAGATATTGCCGTGCTCCCTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000351114    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025307.1-1126s21c1
Sequence:CCGGCATCCAACGGCAGCTTGAAATCTCGAGATTTCAAGCTGCCGTTGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380739    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025307.1-1068s21c1
Sequence:GTACCGGAGGTGATGACAAAGTACAATGCTCGAGCATTGTACTTTGTCATCACCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381656    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001025307.1-1801s21c1
Sequence:GTACCGGTAACGAACGGGTCCCTGTTTACTCGAGTAAACAGGGACCCGTTCGTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001025307.1-735s21c1
Sequence:GTACCGGACACGGACGAGGTTGAGATTGCTCGAGCAATCTCAACCTCGTCCGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110510    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001025307.1-1660s1c1
Sequence:CCGGGCACCAATCAACTGTTTATTACTCGAGTAATAAACAGTTGATTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025307.1-1138s1c1
Sequence:CCGGGCTTGAAATTACTGGCAAGAACTCGAGTTCTTGCCAGTAATTTCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025307.1-740s1c1
Sequence:CCGGGACGAGGTTGAGATTGCCATTCTCGAGAATGGCAATCTCAACCTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110514    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025307.1-1489s1c1
Sequence:CCGGCTGCTGTATTATCCTTGCCATCTCGAGATGGCAAGGATAATACAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000110511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001025307.1-1439s1c1
Sequence:CCGGGCGGTCAAGTATCAGAGTGAACTCGAGTTCACTCTGATACTTGACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks