EMAIL THIS PAGE TO A FRIEND

STX4

syntaxin 4

Synonyms: STX4A p35-2
UniProtKB ID: Q12846, Q15525, Q6FHE8
Gene ID:
Rat(81803) syntaxin 4
Zebrafish(323735) syntaxin 4
dog(489919) syntaxin 4
cow(508675) syntaxin 4
sheep(101103527) syntaxin 4
46 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004604 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004604 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004604 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU033151 MISSION® esiRNA esiRNA human STX4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004604 Rosetta Predictions human pricing
NM_031125 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004604 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00117045 predicted 799
2 SASI_Hs01_00117046 predicted 636
3 SASI_Hs01_00117047 predicted 1105
4 SASI_Hs01_00117049 predicted 869
5 SASI_Hs01_00117050 predicted 804
6 SASI_Hs01_00117051 predicted 678
7 SASI_Hs01_00117053 predicted 1070
8 SASI_Hs01_00117054 predicted 637
9 SASI_Hs02_00337982 predicted 760
10 SASI_Hs02_00337983 predicted 855
11 SASI_Hs01_00117048 predicted 683
12 SASI_Hs01_00117052 predicted 1032
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031125 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00038279 predicted 356
2 SASI_Rn01_00038280 predicted 734
3 SASI_Rn01_00038281 predicted 566
4 SASI_Rn01_00038282 predicted 733
5 SASI_Rn01_00038283 predicted 572
6 SASI_Rn01_00038285 predicted 315
7 SASI_Rn01_00038286 predicted 431
8 SASI_Rn01_00038287 predicted 346
9 SASI_Rn02_00264438 predicted 568
10 SASI_Rn01_00038288 predicted 448
11 SASI_Rn01_00038284 predicted 224
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004604
VALIDATED
STX4 MISSION shRNA Bacterial Glycerol Stock
syntaxin 4
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000065023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004604.3-574s1c1
Sequence:CCGGCCGTCAACACAAGAATGAGAACTCGAGTTCTCATTCTTGTGTTGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004604.3-881s1c1
Sequence:CCGGGCTGCACGACATATTCACTTTCTCGAGAAAGTGAATATGTCGTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004604.3-360s1c1
Sequence:CCGGCGGACAATTCGGCAGACTATTCTCGAGAATAGTCTGCCGAATTGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004604.3-855s1c1
Sequence:CCGGCAGCAGCTTGAACGCAGTATTCTCGAGAATACTGCGTTCAAGCTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065025    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004604.3-646s1c1
Sequence:CCGGGCAATTCAATGCAGTCCGAATCTCGAGATTCGGACTGCATTGAATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380073    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004604.3-807s21c1
Sequence:GTACCGGGTGACTCGACAGGCCTTAAATCTCGAGATTTAAGGCCTGTCGAGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299048    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004604.3-574s21c1
Sequence:CCGGCCGTCAACACAAGAATGAGAACTCGAGTTCTCATTCTTGTGTTGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298978    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004604.3-646s21c1
Sequence:CCGGGCAATTCAATGCAGTCCGAATCTCGAGATTCGGACTGCATTGAATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298980    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004604.3-881s21c1
Sequence:CCGGGCTGCACGACATATTCACTTTCTCGAGAAAGTGAATATGTCGTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004604.3-855s21c1
Sequence:CCGGCAGCAGCTTGAACGCAGTATTCTCGAGAATACTGCGTTCAAGCTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004604.3-360s21c1
Sequence:CCGGCGGACAATTCGGCAGACTATTCTCGAGAATAGTCTGCCGAATTGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004604
VALIDATED
STX4 MISSION shRNA shRNA Plasmid DNA
syntaxin 4
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000065023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004604.3-574s1c1
Sequence:CCGGCCGTCAACACAAGAATGAGAACTCGAGTTCTCATTCTTGTGTTGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004604.3-881s1c1
Sequence:CCGGGCTGCACGACATATTCACTTTCTCGAGAAAGTGAATATGTCGTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004604.3-360s1c1
Sequence:CCGGCGGACAATTCGGCAGACTATTCTCGAGAATAGTCTGCCGAATTGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004604.3-855s1c1
Sequence:CCGGCAGCAGCTTGAACGCAGTATTCTCGAGAATACTGCGTTCAAGCTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065025    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004604.3-646s1c1
Sequence:CCGGGCAATTCAATGCAGTCCGAATCTCGAGATTCGGACTGCATTGAATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380073    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004604.3-807s21c1
Sequence:GTACCGGGTGACTCGACAGGCCTTAAATCTCGAGATTTAAGGCCTGTCGAGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299048    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004604.3-574s21c1
Sequence:CCGGCCGTCAACACAAGAATGAGAACTCGAGTTCTCATTCTTGTGTTGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298978    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004604.3-646s21c1
Sequence:CCGGGCAATTCAATGCAGTCCGAATCTCGAGATTCGGACTGCATTGAATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298980    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004604.3-881s21c1
Sequence:CCGGGCTGCACGACATATTCACTTTCTCGAGAAAGTGAATATGTCGTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004604.3-855s21c1
Sequence:CCGGCAGCAGCTTGAACGCAGTATTCTCGAGAATACTGCGTTCAAGCTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004604.3-360s21c1
Sequence:CCGGCGGACAATTCGGCAGACTATTCTCGAGAATAGTCTGCCGAATTGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004604
VALIDATED
STX4 MISSION shRNA Lentiviral Transduction Particles
syntaxin 4
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000065023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004604.3-574s1c1
Sequence:CCGGCCGTCAACACAAGAATGAGAACTCGAGTTCTCATTCTTGTGTTGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004604.3-881s1c1
Sequence:CCGGGCTGCACGACATATTCACTTTCTCGAGAAAGTGAATATGTCGTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004604.3-360s1c1
Sequence:CCGGCGGACAATTCGGCAGACTATTCTCGAGAATAGTCTGCCGAATTGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004604.3-855s1c1
Sequence:CCGGCAGCAGCTTGAACGCAGTATTCTCGAGAATACTGCGTTCAAGCTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065025    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_004604.3-646s1c1
Sequence:CCGGGCAATTCAATGCAGTCCGAATCTCGAGATTCGGACTGCATTGAATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380073    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004604.3-807s21c1
Sequence:GTACCGGGTGACTCGACAGGCCTTAAATCTCGAGATTTAAGGCCTGTCGAGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299048    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004604.3-574s21c1
Sequence:CCGGCCGTCAACACAAGAATGAGAACTCGAGTTCTCATTCTTGTGTTGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298978    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_004604.3-646s21c1
Sequence:CCGGGCAATTCAATGCAGTCCGAATCTCGAGATTCGGACTGCATTGAATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298980    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004604.3-881s21c1
Sequence:CCGGGCTGCACGACATATTCACTTTCTCGAGAAAGTGAATATGTCGTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299049    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004604.3-855s21c1
Sequence:CCGGCAGCAGCTTGAACGCAGTATTCTCGAGAATACTGCGTTCAAGCTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299046    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004604.3-360s21c1
Sequence:CCGGCGGACAATTCGGCAGACTATTCTCGAGAATAGTCTGCCGAATTGTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks