EMAIL THIS PAGE TO A FRIEND

STX5

syntaxin 5

Synonyms: SED5 STX5A
UniProtKB ID: Q13190, B2R8T2, Q5U0D4, Q7Z3T6, Q9BUG1
Gene ID:
Human(6811) Summary: This gene encodes a member of the syntaxin or t-SNARE (target-SNAP receptor) family. These proteins are found on cell membranes and serve as the targets for v-SNAREs (vesicle-SNAP receptors), permitting specific synaptic vesicle docking and fusion. The encoded protein regulates endoplasmic reticulum to Golgi transport and plays a critical role in autophagy. Autoantibodies targeting the encoded protein may be a diagnostic marker for endometriosis. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Sep 2011]
Rat(65134) syntaxin 5
cow(510312) syntaxin 5
sheep(101115585) syntaxin 5
dog(483779) syntaxin 5
91 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA001358 Anti-STX5 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB2701187 Anti-STX5 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human, rat
immunofluorescence, immunohistochemistry, western blot pricing
WH0006811M1 Monoclonal Anti-STX5A antibody produced in mouse clone 5A6, purified immunoglobulin, buffered aqueous solution human, mouse, rat
ELISA, immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003164 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003164 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003164 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU012041 MISSION® esiRNA esiRNA targeting human STX5 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003164 Rosetta Predictions human pricing
NM_031704 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003164 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00099167 predicted 967
2 SASI_Hs01_00099170 predicted 702
3 SASI_Hs01_00099171 predicted 701
4 SASI_Hs02_00335173 predicted 1499
5 SASI_Hs01_00099172 predicted 557
6 SASI_Hs02_00335174 predicted 1502
7 SASI_Hs01_00099174 predicted 550
8 SASI_Hs01_00099175 predicted 966
9 SASI_Hs02_00335175 predicted 707
10 SASI_Hs02_00335176 predicted 1045
11 SASI_Hs01_00099166 predicted 539
12 SASI_Hs01_00099168 predicted 1437
13 SASI_Hs01_00099169 predicted 977
14 SASI_Hs01_00099173 predicted 561
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031704 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00086445 predicted 369
2 SASI_Rn01_00086446 predicted 649
3 SASI_Rn02_00265061 predicted 333
4 SASI_Rn01_00086447 predicted 786
5 SASI_Rn01_00086448 predicted 857
6 SASI_Rn01_00086449 predicted 392
7 SASI_Rn01_00086450 predicted 852
8 SASI_Rn01_00086451 predicted 265
9 SASI_Rn01_00086452 predicted 338
10 SASI_Rn01_00086453 predicted 485
11 SASI_Rn01_00086454 predicted 929
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003164
VALIDATED
STX5 MISSION shRNA Bacterial Glycerol Stock
syntaxin 5
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000059823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003164.2-368s1c1
Sequence:CCGGCCAGACAAATAAGCCAGCTTTCTCGAGAAAGCTGGCTTATTTGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:NM_003164.2-953s1c1
Sequence:CCGGGCAGAACATTGAGTCGACAATCTCGAGATTGTCGACTCAATGTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003164.2-671s1c1
Sequence:CCGGGCAGTCGAAACTGGCTTCTATCTCGAGATAGAAGCCAGTTTCGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003164.2-1088s1c1
Sequence:CCGGCCATTCAGAGATCCTCAAGTACTCGAGTACTTGAGGATCTCTGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_003164.2-446s1c1
Sequence:CCGGCCTTAGCAACACATTTGCCAACTCGAGTTGGCAAATGTGTTGCTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_003164.3-379s21c1
Sequence:CCGGGAATGGAATCCAGACAAATAACTCGAGTTATTTGTCTGGATTCCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230317    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_003164.3-974s21c1
Sequence:CCGGCAGAACATTGAGTCGACAATTCTCGAGAATTGTCGACTCAATGTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_003164.3-517s21c1
Sequence:GTACCGGCAAGTCCCTCTTTGATGATAACTCGAGTTATCATCAAAGAGGGACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230318    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_003164.3-1313s21c1
Sequence:CCGGTTGGGAGAAAGGCCCTGTTTCCTCGAGGAAACAGGGCCTTTCTCCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_003164.3-545s21c1
Sequence:CCGGGAAATTGAAGAGCTAACATATCTCGAGATATGTTAGCTCTTCAATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003164
VALIDATED
STX5 MISSION shRNA shRNA Plasmid DNA
syntaxin 5
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000059823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003164.2-368s1c1
Sequence:CCGGCCAGACAAATAAGCCAGCTTTCTCGAGAAAGCTGGCTTATTTGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:NM_003164.2-953s1c1
Sequence:CCGGGCAGAACATTGAGTCGACAATCTCGAGATTGTCGACTCAATGTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003164.2-671s1c1
Sequence:CCGGGCAGTCGAAACTGGCTTCTATCTCGAGATAGAAGCCAGTTTCGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003164.2-1088s1c1
Sequence:CCGGCCATTCAGAGATCCTCAAGTACTCGAGTACTTGAGGATCTCTGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_003164.2-446s1c1
Sequence:CCGGCCTTAGCAACACATTTGCCAACTCGAGTTGGCAAATGTGTTGCTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_003164.3-379s21c1
Sequence:CCGGGAATGGAATCCAGACAAATAACTCGAGTTATTTGTCTGGATTCCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230317    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_003164.3-974s21c1
Sequence:CCGGCAGAACATTGAGTCGACAATTCTCGAGAATTGTCGACTCAATGTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_003164.3-517s21c1
Sequence:GTACCGGCAAGTCCCTCTTTGATGATAACTCGAGTTATCATCAAAGAGGGACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230318    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_003164.3-1313s21c1
Sequence:CCGGTTGGGAGAAAGGCCCTGTTTCCTCGAGGAAACAGGGCCTTTCTCCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_003164.3-545s21c1
Sequence:CCGGGAAATTGAAGAGCTAACATATCTCGAGATATGTTAGCTCTTCAATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003164
VALIDATED
STX5 MISSION shRNA Lentiviral Transduction Particles
syntaxin 5
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000059823    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003164.2-368s1c1
Sequence:CCGGCCAGACAAATAAGCCAGCTTTCTCGAGAAAGCTGGCTTATTTGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:NM_003164.2-953s1c1
Sequence:CCGGGCAGAACATTGAGTCGACAATCTCGAGATTGTCGACTCAATGTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003164.2-671s1c1
Sequence:CCGGGCAGTCGAAACTGGCTTCTATCTCGAGATAGAAGCCAGTTTCGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_003164.2-1088s1c1
Sequence:CCGGCCATTCAGAGATCCTCAAGTACTCGAGTACTTGAGGATCTCTGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A3
TRC Version: 1 Clone ID:NM_003164.2-446s1c1
Sequence:CCGGCCTTAGCAACACATTTGCCAACTCGAGTTGGCAAATGTGTTGCTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230315    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_003164.3-379s21c1
Sequence:CCGGGAATGGAATCCAGACAAATAACTCGAGTTATTTGTCTGGATTCCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230317    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_003164.3-974s21c1
Sequence:CCGGCAGAACATTGAGTCGACAATTCTCGAGAATTGTCGACTCAATGTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218714    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_003164.3-517s21c1
Sequence:GTACCGGCAAGTCCCTCTTTGATGATAACTCGAGTTATCATCAAAGAGGGACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230318    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_003164.3-1313s21c1
Sequence:CCGGTTGGGAGAAAGGCCCTGTTTCCTCGAGGAAACAGGGCCTTTCTCCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_003164.3-545s21c1
Sequence:CCGGGAAATTGAAGAGCTAACATATCTCGAGATATGTTAGCTCTTCAATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks