EMAIL THIS PAGE TO A FRIEND

STX6

syntaxin 6

UniProtKB ID: O43752, B2R652, Q5VY08, Q6FH83
Gene ID:
Mouse(58244) syntaxin 6
Rat(60562) syntaxin 6
Zebrafish(550577) syntaxin 6
chicken(424413) syntaxin 6
dog(490303) syntaxin 6
cow(510909) syntaxin 6
sheep(101123650) syntaxin 6
164 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021433 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021433 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021433 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005819 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005819 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005819 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU076051 MISSION® esiRNA esiRNA targeting mouse Stx6 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005819 Rosetta Predictions human pricing
NM_031665 Rosetta Predictions rat pricing
NM_021433 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005819 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00129146 predicted 525
2 SASI_Hs01_00129147 predicted 384
3 SASI_Hs01_00129148 predicted 542
4 SASI_Hs01_00129149 predicted 828
5 SASI_Hs01_00129150 predicted 505
6 SASI_Hs01_00129151 predicted 474
7 SASI_Hs01_00129152 predicted 682
8 SASI_Hs01_00129153 predicted 830
9 SASI_Hs01_00129154 predicted 536
10 SASI_Hs01_00129155 predicted 393
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031665 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00108874 predicted 447
2 SASI_Rn01_00108875 predicted 197
3 SASI_Rn01_00108876 predicted 441
4 SASI_Rn01_00108877 predicted 762
5 SASI_Rn01_00108878 predicted 523
6 SASI_Rn01_00108879 predicted 553
7 SASI_Rn01_00108880 predicted 303
8 SASI_Rn02_00265006 predicted 368
9 SASI_Rn01_00108881 predicted 452
10 SASI_Rn01_00108882 predicted 487
11 SASI_Rn01_00108883 predicted 992
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021433 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00068554 predicted 476
2 SASI_Mm01_00068555 predicted 431
3 SASI_Mm01_00068556 predicted 1271
4 SASI_Mm01_00068557 predicted 337
5 SASI_Mm01_00068559 predicted 497
6 SASI_Mm01_00068560 predicted 461
7 SASI_Mm01_00068561 predicted 422
8 SASI_Mm01_00068562 predicted 579
9 SASI_Mm01_00068563 predicted 784
10 SASI_Mm02_00326076 predicted 1336
11 SASI_Mm01_00068558 predicted 992
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021433
VALIDATED
STX6 MISSION shRNA Bacterial Glycerol Stock
syntaxin 6
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000115078    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021433.2-803s1c1
Sequence:CCGGCGTGATGAAGAAACTTGCAAACTCGAGTTTGCAAGTTTCTTCATCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021433.2-353s1c1
Sequence:CCGGCATCAGCATAGTTGAAGCAAACTCGAGTTTGCTTCAACTATGCTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115076    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021433.2-1468s1c1
Sequence:CCGGGCTGGGTAAGAGTTGAGATTACTCGAGTAATCTCAACTCTTACCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021433.2-352s1c1
Sequence:CCGGCCATCAGCATAGTTGAAGCAACTCGAGTTGCTTCAACTATGCTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021433.2-303s1c1
Sequence:CCGGAGGAACAATCTCCGCAGCATACTCGAGTATGCTGCGGAGATTGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021433.3-464s21c1
Sequence:CCGGATCACAAGTACTCGGCAAATTCTCGAGAATTTGCCGAGTACTTGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021433.3-841s21c1
Sequence:CCGGCGTGATGAAGAAACTTGCAAACTCGAGTTTGCAAGTTTCTTCATCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339680    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021433.3-1506s21c1
Sequence:CCGGGCTGGGTAAGAGTTGAGATTACTCGAGTAATCTCAACTCTTACCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021433.3-390s21c1
Sequence:CCGGCCATCAGCATAGTTGAAGCAACTCGAGTTGCTTCAACTATGCTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021433.3-781s21c1
Sequence:GTACCGGGGCCGTCATGCTAGATGATTTCTCGAGAAATCATCTAGCATGACGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021433.3-246s21c1
Sequence:GTACCGGACACTGCCCAAGGATTGTTTCCTCGAGGAAACAATCCTTGGGCAGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021433
VALIDATED
STX6 MISSION shRNA shRNA Plasmid DNA
syntaxin 6
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000115078    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021433.2-803s1c1
Sequence:CCGGCGTGATGAAGAAACTTGCAAACTCGAGTTTGCAAGTTTCTTCATCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021433.2-353s1c1
Sequence:CCGGCATCAGCATAGTTGAAGCAAACTCGAGTTTGCTTCAACTATGCTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115076    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021433.2-1468s1c1
Sequence:CCGGGCTGGGTAAGAGTTGAGATTACTCGAGTAATCTCAACTCTTACCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021433.2-352s1c1
Sequence:CCGGCCATCAGCATAGTTGAAGCAACTCGAGTTGCTTCAACTATGCTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021433.2-303s1c1
Sequence:CCGGAGGAACAATCTCCGCAGCATACTCGAGTATGCTGCGGAGATTGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021433.3-464s21c1
Sequence:CCGGATCACAAGTACTCGGCAAATTCTCGAGAATTTGCCGAGTACTTGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021433.3-841s21c1
Sequence:CCGGCGTGATGAAGAAACTTGCAAACTCGAGTTTGCAAGTTTCTTCATCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339680    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021433.3-1506s21c1
Sequence:CCGGGCTGGGTAAGAGTTGAGATTACTCGAGTAATCTCAACTCTTACCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021433.3-390s21c1
Sequence:CCGGCCATCAGCATAGTTGAAGCAACTCGAGTTGCTTCAACTATGCTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021433.3-781s21c1
Sequence:GTACCGGGGCCGTCATGCTAGATGATTTCTCGAGAAATCATCTAGCATGACGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021433.3-246s21c1
Sequence:GTACCGGACACTGCCCAAGGATTGTTTCCTCGAGGAAACAATCCTTGGGCAGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021433
VALIDATED
STX6 MISSION shRNA Lentiviral Transduction Particles
syntaxin 6
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000115078    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021433.2-803s1c1
Sequence:CCGGCGTGATGAAGAAACTTGCAAACTCGAGTTTGCAAGTTTCTTCATCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021433.2-353s1c1
Sequence:CCGGCATCAGCATAGTTGAAGCAAACTCGAGTTTGCTTCAACTATGCTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115076    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021433.2-1468s1c1
Sequence:CCGGGCTGGGTAAGAGTTGAGATTACTCGAGTAATCTCAACTCTTACCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115077    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021433.2-352s1c1
Sequence:CCGGCCATCAGCATAGTTGAAGCAACTCGAGTTGCTTCAACTATGCTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021433.2-303s1c1
Sequence:CCGGAGGAACAATCTCCGCAGCATACTCGAGTATGCTGCGGAGATTGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021433.3-464s21c1
Sequence:CCGGATCACAAGTACTCGGCAAATTCTCGAGAATTTGCCGAGTACTTGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339605    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021433.3-841s21c1
Sequence:CCGGCGTGATGAAGAAACTTGCAAACTCGAGTTTGCAAGTTTCTTCATCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339680    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021433.3-1506s21c1
Sequence:CCGGGCTGGGTAAGAGTTGAGATTACTCGAGTAATCTCAACTCTTACCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339679    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021433.3-390s21c1
Sequence:CCGGCCATCAGCATAGTTGAAGCAACTCGAGTTGCTTCAACTATGCTGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379491    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021433.3-781s21c1
Sequence:GTACCGGGGCCGTCATGCTAGATGATTTCTCGAGAAATCATCTAGCATGACGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021433.3-246s21c1
Sequence:GTACCGGACACTGCCCAAGGATTGTTTCCTCGAGGAAACAATCCTTGGGCAGTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005819
VALIDATED
STX6 MISSION shRNA Bacterial Glycerol Stock
syntaxin 6
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000059463    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_005819.3-504s1c1
Sequence:CCGGGCAGGCATTAGCTGAAAGAAACTCGAGTTTCTTTCAGCTAATGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_005819.3-279s1c1
Sequence:CCGGCACAGCAACAAGGGAAGAAATCTCGAGATTTCTTCCCTTGTTGCTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_005819.3-817s1c1
Sequence:CCGGGACAATGTGATGAAGAAACTTCTCGAGAAGTTTCTTCATCACATTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059465    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A3
TRC Version: 1 Clone ID:NM_005819.3-569s1c1
Sequence:CCGGGCACTGGAACAACAGATAAATCTCGAGATTTATCTGTTGTTCCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_005819.3-377s1c1
Sequence:CCGGGCATAGTTGAAGCAAATCCTACTCGAGTAGGATTTGCTTCAACTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380793    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_005819.4-1446s21c1
Sequence:GTACCGGACGAGCTTCTGGGTATGTTTCCTCGAGGAAACATACCCAGAAGCTCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005819.4-570s21c1
Sequence:CCGGGCAGGCATTAGCTGAAAGAAACTCGAGTTTCTTTCAGCTAATGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_005819.4-443s21c1
Sequence:CCGGGCATAGTTGAAGCAAATCCTACTCGAGTAGGATTTGCTTCAACTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005819.4-345s21c1
Sequence:CCGGCACAGCAACAAGGGAAGAAATCTCGAGATTTCTTCCCTTGTTGCTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291944    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005819.4-883s21c1
Sequence:CCGGGACAATGTGATGAAGAAACTTCTCGAGAAGTTTCTTCATCACATTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_005819.4-635s21c1
Sequence:CCGGGCACTGGAACAACAGATAAATCTCGAGATTTATCTGTTGTTCCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_005819.4-479s21c1
Sequence:GTACCGGATGCAACTGAATTGAGTATAACTCGAGTTATACTCAATTCAGTTGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_005819.4-944s21c1
Sequence:GTACCGGGTGCCATAGCCATCCTCTTTGCTCGAGCAAAGAGGATGGCTATGGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005819
VALIDATED
STX6 MISSION shRNA shRNA Plasmid DNA
syntaxin 6
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000059463    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_005819.3-504s1c1
Sequence:CCGGGCAGGCATTAGCTGAAAGAAACTCGAGTTTCTTTCAGCTAATGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_005819.3-279s1c1
Sequence:CCGGCACAGCAACAAGGGAAGAAATCTCGAGATTTCTTCCCTTGTTGCTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_005819.3-817s1c1
Sequence:CCGGGACAATGTGATGAAGAAACTTCTCGAGAAGTTTCTTCATCACATTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059465    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A3
TRC Version: 1 Clone ID:NM_005819.3-569s1c1
Sequence:CCGGGCACTGGAACAACAGATAAATCTCGAGATTTATCTGTTGTTCCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_005819.3-377s1c1
Sequence:CCGGGCATAGTTGAAGCAAATCCTACTCGAGTAGGATTTGCTTCAACTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380793    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_005819.4-1446s21c1
Sequence:GTACCGGACGAGCTTCTGGGTATGTTTCCTCGAGGAAACATACCCAGAAGCTCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005819.4-570s21c1
Sequence:CCGGGCAGGCATTAGCTGAAAGAAACTCGAGTTTCTTTCAGCTAATGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_005819.4-443s21c1
Sequence:CCGGGCATAGTTGAAGCAAATCCTACTCGAGTAGGATTTGCTTCAACTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005819.4-345s21c1
Sequence:CCGGCACAGCAACAAGGGAAGAAATCTCGAGATTTCTTCCCTTGTTGCTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291944    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005819.4-883s21c1
Sequence:CCGGGACAATGTGATGAAGAAACTTCTCGAGAAGTTTCTTCATCACATTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_005819.4-635s21c1
Sequence:CCGGGCACTGGAACAACAGATAAATCTCGAGATTTATCTGTTGTTCCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_005819.4-479s21c1
Sequence:GTACCGGATGCAACTGAATTGAGTATAACTCGAGTTATACTCAATTCAGTTGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_005819.4-944s21c1
Sequence:GTACCGGGTGCCATAGCCATCCTCTTTGCTCGAGCAAAGAGGATGGCTATGGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005819
VALIDATED
STX6 MISSION shRNA Lentiviral Transduction Particles
syntaxin 6
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000059463    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_005819.3-504s1c1
Sequence:CCGGGCAGGCATTAGCTGAAAGAAACTCGAGTTTCTTTCAGCTAATGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_005819.3-279s1c1
Sequence:CCGGCACAGCAACAAGGGAAGAAATCTCGAGATTTCTTCCCTTGTTGCTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059466    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_005819.3-817s1c1
Sequence:CCGGGACAATGTGATGAAGAAACTTCTCGAGAAGTTTCTTCATCACATTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059465    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A3
TRC Version: 1 Clone ID:NM_005819.3-569s1c1
Sequence:CCGGGCACTGGAACAACAGATAAATCTCGAGATTTATCTGTTGTTCCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059464    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_005819.3-377s1c1
Sequence:CCGGGCATAGTTGAAGCAAATCCTACTCGAGTAGGATTTGCTTCAACTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380793    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_005819.4-1446s21c1
Sequence:GTACCGGACGAGCTTCTGGGTATGTTTCCTCGAGGAAACATACCCAGAAGCTCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291917    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005819.4-570s21c1
Sequence:CCGGGCAGGCATTAGCTGAAAGAAACTCGAGTTTCTTTCAGCTAATGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291946    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_005819.4-443s21c1
Sequence:CCGGGCATAGTTGAAGCAAATCCTACTCGAGTAGGATTTGCTTCAACTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005819.4-345s21c1
Sequence:CCGGCACAGCAACAAGGGAAGAAATCTCGAGATTTCTTCCCTTGTTGCTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291944    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005819.4-883s21c1
Sequence:CCGGGACAATGTGATGAAGAAACTTCTCGAGAAGTTTCTTCATCACATTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307853    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_005819.4-635s21c1
Sequence:CCGGGCACTGGAACAACAGATAAATCTCGAGATTTATCTGTTGTTCCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_005819.4-479s21c1
Sequence:GTACCGGATGCAACTGAATTGAGTATAACTCGAGTTATACTCAATTCAGTTGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 2 Clone ID:NM_005819.4-944s21c1
Sequence:GTACCGGGTGCCATAGCCATCCTCTTTGCTCGAGCAAAGAGGATGGCTATGGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks