EMAIL THIS PAGE TO A FRIEND

STX7

syntaxin 7

UniProtKB ID: O15400, E1P579, Q5SZW2, Q96ES9
Gene ID:
Mouse(53331) syntaxin 7
Rat(60466) syntaxin 7
cow(507031) syntaxin 7
sheep(101123563) syntaxin 7
chicken(426930) syntaxin 7
dog(483987) syntaxin 7
106 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0253 AQUA Peptide EFGFLPTTPSEQ[R] rat pricing
AQ0252 AQUA Peptide TLNQLGTPQDTPEL[R] rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016797 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016797 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016797 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003569 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003569 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003569 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003569 Rosetta Predictions human pricing
NM_021869 Rosetta Predictions rat pricing
NM_016797 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003569 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00171210 predicted 592
2 SASI_Hs02_00335876 predicted 741
3 SASI_Hs02_00335877 predicted 460
4 SASI_Hs02_00335878 predicted 491
5 SASI_Hs01_00171213 predicted 533
6 SASI_Hs01_00171214 predicted 839
7 SASI_Hs02_00335879 predicted 747
8 SASI_Hs01_00171217 predicted 549
9 SASI_Hs01_00171218 predicted 759
10 SASI_Hs01_00171211 predicted 753
11 SASI_Hs01_00171212 predicted 240
12 SASI_Hs01_00171215 predicted 220
13 SASI_Hs01_00171216 predicted 275
14 SASI_Hs01_00171219 predicted 533
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021869 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00063225 predicted 834
2 SASI_Rn01_00063226 predicted 959
3 SASI_Rn01_00063227 predicted 634
4 SASI_Rn01_00063228 predicted 286
5 SASI_Rn01_00063229 predicted 771
6 SASI_Rn01_00063230 predicted 308
7 SASI_Rn01_00063232 predicted 759
8 SASI_Rn02_00262901 predicted 633
9 SASI_Rn01_00063233 predicted 271
10 SASI_Rn01_00063234 predicted 386
11 SASI_Rn01_00063231 predicted 477
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016797 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00323580 predicted 547
2 SASI_Mm01_00049046 predicted 734
3 SASI_Mm01_00049047 predicted 1071
4 SASI_Mm01_00049048 predicted 580
5 SASI_Mm01_00049049 predicted 760
6 SASI_Mm01_00049050 predicted 653
7 SASI_Mm01_00049051 predicted 1140
8 SASI_Mm01_00049052 predicted 925
9 SASI_Mm01_00049054 predicted 819
10 SASI_Mm01_00049055 predicted 733
11 SASI_Mm01_00049053 predicted 384
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016797
VALIDATED
STX7 MISSION shRNA Bacterial Glycerol Stock
syntaxin 7
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000324558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016797.4-1075s21c1
Sequence:CCGGCGATATGATTGACAGCATAGACTCGAGTCTATGCTGTCAATCATATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324557    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016797.4-1097s21c1
Sequence:CCGGGCCAATGTAGAAAGTGCGGAACTCGAGTTCCGCACTTTCTACATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016797.4-724s21c1
Sequence:CCGGGCGTCAGAGAAAGATACAGAACTCGAGTTCTGTATCTTTCTCTGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324555    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016797.4-2022s21c1
Sequence:CCGGCCAGTCTCTTACTGCACTGAACTCGAGTTCAGTGCAGTAAGAGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016797.4-1010s21c1
Sequence:CCGGGAAGCTGATATTATGGACATTCTCGAGAATGTCCATAATATCAGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100560    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016797.2-1662s1c1
Sequence:CCGGCCAGTCTCTTACTGCACTGAACTCGAGTTCAGTGCAGTAAGAGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100561    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016797.2-364s1c1
Sequence:CCGGGCGTCAGAGAAAGATACAGAACTCGAGTTCTGTATCTTTCTCTGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016797.2-650s1c1
Sequence:CCGGGAAGCTGATATTATGGACATTCTCGAGAATGTCCATAATATCAGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016797.2-715s1c1
Sequence:CCGGCGATATGATTGACAGCATAGACTCGAGTCTATGCTGTCAATCATATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016797.2-737s1c1
Sequence:CCGGGCCAATGTAGAAAGTGCGGAACTCGAGTTCCGCACTTTCTACATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016797
VALIDATED
STX7 MISSION shRNA shRNA Plasmid DNA
syntaxin 7
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000324558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016797.4-1075s21c1
Sequence:CCGGCGATATGATTGACAGCATAGACTCGAGTCTATGCTGTCAATCATATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324557    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016797.4-1097s21c1
Sequence:CCGGGCCAATGTAGAAAGTGCGGAACTCGAGTTCCGCACTTTCTACATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016797.4-724s21c1
Sequence:CCGGGCGTCAGAGAAAGATACAGAACTCGAGTTCTGTATCTTTCTCTGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324555    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016797.4-2022s21c1
Sequence:CCGGCCAGTCTCTTACTGCACTGAACTCGAGTTCAGTGCAGTAAGAGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016797.4-1010s21c1
Sequence:CCGGGAAGCTGATATTATGGACATTCTCGAGAATGTCCATAATATCAGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100560    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016797.2-1662s1c1
Sequence:CCGGCCAGTCTCTTACTGCACTGAACTCGAGTTCAGTGCAGTAAGAGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100561    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016797.2-364s1c1
Sequence:CCGGGCGTCAGAGAAAGATACAGAACTCGAGTTCTGTATCTTTCTCTGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016797.2-650s1c1
Sequence:CCGGGAAGCTGATATTATGGACATTCTCGAGAATGTCCATAATATCAGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016797.2-715s1c1
Sequence:CCGGCGATATGATTGACAGCATAGACTCGAGTCTATGCTGTCAATCATATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016797.2-737s1c1
Sequence:CCGGGCCAATGTAGAAAGTGCGGAACTCGAGTTCCGCACTTTCTACATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016797
VALIDATED
STX7 MISSION shRNA Lentiviral Transduction Particles
syntaxin 7
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000324558    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016797.4-1075s21c1
Sequence:CCGGCGATATGATTGACAGCATAGACTCGAGTCTATGCTGTCAATCATATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324557    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016797.4-1097s21c1
Sequence:CCGGGCCAATGTAGAAAGTGCGGAACTCGAGTTCCGCACTTTCTACATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016797.4-724s21c1
Sequence:CCGGGCGTCAGAGAAAGATACAGAACTCGAGTTCTGTATCTTTCTCTGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324555    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016797.4-2022s21c1
Sequence:CCGGCCAGTCTCTTACTGCACTGAACTCGAGTTCAGTGCAGTAAGAGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324478    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016797.4-1010s21c1
Sequence:CCGGGAAGCTGATATTATGGACATTCTCGAGAATGTCCATAATATCAGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100560    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016797.2-1662s1c1
Sequence:CCGGCCAGTCTCTTACTGCACTGAACTCGAGTTCAGTGCAGTAAGAGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100561    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016797.2-364s1c1
Sequence:CCGGGCGTCAGAGAAAGATACAGAACTCGAGTTCTGTATCTTTCTCTGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016797.2-650s1c1
Sequence:CCGGGAAGCTGATATTATGGACATTCTCGAGAATGTCCATAATATCAGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100564    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016797.2-715s1c1
Sequence:CCGGCGATATGATTGACAGCATAGACTCGAGTCTATGCTGTCAATCATATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100562    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016797.2-737s1c1
Sequence:CCGGGCCAATGTAGAAAGTGCGGAACTCGAGTTCCGCACTTTCTACATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003569
VALIDATED
STX7 MISSION shRNA Bacterial Glycerol Stock
syntaxin 7
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000299051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003569.2-295s21c1
Sequence:CCGGCCAGAGGATCTCTTCTAACATCTCGAGATGTTAGAAGAGATCCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003569.2-746s21c1
Sequence:CCGGCGTCTTATTCATGAGAGAGAACTCGAGTTCTCTCTCATGAATAAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298983    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003569.2-998s21c1
Sequence:CCGGGCGATTATCAGTCTCATCATACTCGAGTATGATGAGACTGATAATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003569.2-538s21c1
Sequence:CCGGGTTCACAACATCACTGACAAACTCGAGTTTGTCAGTGATGTTGTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003569.2-930s21c1
Sequence:CCGGCAGCAGATTATCAGCGCAAATCTCGAGATTTGCGCTGATAATCTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065053    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1 Clone ID:NM_003569.1-124s1c1
Sequence:CCGGCCAGAGGATCTCTTCTAACATCTCGAGATGTTAGAAGAGATCCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_003569.1-827s1c1
Sequence:CCGGGCGATTATCAGTCTCATCATACTCGAGTATGATGAGACTGATAATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 1 Clone ID:NM_003569.1-759s1c1
Sequence:CCGGCAGCAGATTATCAGCGCAAATCTCGAGATTTGCGCTGATAATCTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_003569.1-367s1c1
Sequence:CCGGGTTCACAACATCACTGACAAACTCGAGTTTGTCAGTGATGTTGTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065055    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:NM_003569.1-575s1c1
Sequence:CCGGCGTCTTATTCATGAGAGAGAACTCGAGTTCTCTCTCATGAATAAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003569
VALIDATED
STX7 MISSION shRNA shRNA Plasmid DNA
syntaxin 7
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000299051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003569.2-295s21c1
Sequence:CCGGCCAGAGGATCTCTTCTAACATCTCGAGATGTTAGAAGAGATCCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003569.2-746s21c1
Sequence:CCGGCGTCTTATTCATGAGAGAGAACTCGAGTTCTCTCTCATGAATAAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298983    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003569.2-998s21c1
Sequence:CCGGGCGATTATCAGTCTCATCATACTCGAGTATGATGAGACTGATAATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003569.2-538s21c1
Sequence:CCGGGTTCACAACATCACTGACAAACTCGAGTTTGTCAGTGATGTTGTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003569.2-930s21c1
Sequence:CCGGCAGCAGATTATCAGCGCAAATCTCGAGATTTGCGCTGATAATCTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065053    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1 Clone ID:NM_003569.1-124s1c1
Sequence:CCGGCCAGAGGATCTCTTCTAACATCTCGAGATGTTAGAAGAGATCCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_003569.1-827s1c1
Sequence:CCGGGCGATTATCAGTCTCATCATACTCGAGTATGATGAGACTGATAATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 1 Clone ID:NM_003569.1-759s1c1
Sequence:CCGGCAGCAGATTATCAGCGCAAATCTCGAGATTTGCGCTGATAATCTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_003569.1-367s1c1
Sequence:CCGGGTTCACAACATCACTGACAAACTCGAGTTTGTCAGTGATGTTGTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065055    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:NM_003569.1-575s1c1
Sequence:CCGGCGTCTTATTCATGAGAGAGAACTCGAGTTCTCTCTCATGAATAAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003569
VALIDATED
STX7 MISSION shRNA Lentiviral Transduction Particles
syntaxin 7
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000299051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003569.2-295s21c1
Sequence:CCGGCCAGAGGATCTCTTCTAACATCTCGAGATGTTAGAAGAGATCCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003569.2-746s21c1
Sequence:CCGGCGTCTTATTCATGAGAGAGAACTCGAGTTCTCTCTCATGAATAAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298983    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003569.2-998s21c1
Sequence:CCGGGCGATTATCAGTCTCATCATACTCGAGTATGATGAGACTGATAATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298982    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003569.2-538s21c1
Sequence:CCGGGTTCACAACATCACTGACAAACTCGAGTTTGTCAGTGATGTTGTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003569.2-930s21c1
Sequence:CCGGCAGCAGATTATCAGCGCAAATCTCGAGATTTGCGCTGATAATCTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065053    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A3
TRC Version: 1 Clone ID:NM_003569.1-124s1c1
Sequence:CCGGCCAGAGGATCTCTTCTAACATCTCGAGATGTTAGAAGAGATCCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_003569.1-827s1c1
Sequence:CCGGGCGATTATCAGTCTCATCATACTCGAGTATGATGAGACTGATAATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 1 Clone ID:NM_003569.1-759s1c1
Sequence:CCGGCAGCAGATTATCAGCGCAAATCTCGAGATTTGCGCTGATAATCTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065057    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_003569.1-367s1c1
Sequence:CCGGGTTCACAACATCACTGACAAACTCGAGTTTGTCAGTGATGTTGTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065055    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A3
TRC Version: 1 Clone ID:NM_003569.1-575s1c1
Sequence:CCGGCGTCTTATTCATGAGAGAGAACTCGAGTTCTCTCTCATGAATAAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks