EMAIL THIS PAGE TO A FRIEND

STX8

syntaxin 8

Synonyms: CARB
UniProtKB ID: Q9UNK0, O60712, Q53XT8
Gene ID:
Human(9482) Summary: The gene is a member of the syntaxin family. The encoded protein is involved in protein trafficking from early to late endosomes via vesicle fusion and exocytosis. A related pseudogene has been identified on chromosome 12. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2010]
Mouse(55943) syntaxin 8
Rat(59074) syntaxin 8
Zebrafish(393346) syntaxin 8
chicken(417321) syntaxin 8
dog(479499) syntaxin 8
cow(613567) syntaxin 8
sheep(101110251) syntaxin 8
56 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018768 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_018768 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_018768 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004853 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004853 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004853 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004853 Rosetta Predictions human pricing
NM_031656 Rosetta Predictions rat pricing
NM_018768 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004853 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00018384 predicted 416
2 SASI_Hs01_00018386 predicted 703
3 SASI_Hs02_00338453 predicted 474
4 SASI_Hs02_00338454 predicted 255
5 SASI_Hs01_00018389 predicted 227
6 SASI_Hs01_00018390 predicted 335
7 SASI_Hs01_00018391 predicted 738
8 SASI_Hs01_00018392 predicted 478
9 SASI_Hs01_00018393 predicted 388
10 SASI_Hs02_00338455 predicted 325
11 SASI_Hs01_00018385 predicted 657
12 SASI_Hs01_00018387 predicted 463
13 SASI_Hs01_00018388 predicted 287
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031656 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00106924 predicted 198
2 SASI_Rn01_00106926 predicted 432
3 SASI_Rn01_00106927 predicted 428
4 SASI_Rn01_00106928 predicted 273
5 SASI_Rn01_00106929 predicted 214
6 SASI_Rn01_00106930 predicted 212
7 SASI_Rn01_00106931 predicted 211
8 SASI_Rn01_00106932 predicted 256
9 SASI_Rn01_00106933 predicted 195
10 SASI_Rn02_00264995 predicted 270
11 SASI_Rn01_00106925 predicted 265
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018768 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00178349 predicted 689
2 SASI_Mm01_00178350 predicted 749
3 SASI_Mm01_00178351 predicted 716
4 SASI_Mm01_00178352 predicted 533
5 SASI_Mm01_00178353 predicted 208
6 SASI_Mm01_00178354 predicted 1089
7 SASI_Mm01_00178355 predicted 199
8 SASI_Mm01_00178356 predicted 790
9 SASI_Mm01_00178357 predicted 1120
10 SASI_Mm01_00178358 predicted 1046
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018768
VALIDATED
STX8 MISSION shRNA Bacterial Glycerol Stock
syntaxin 8
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000100870    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018768.2-917s1c1
Sequence:CCGGCCCTGTCTTCTGTCAGTGATTCTCGAGAATCACTGACAGAAGACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100871    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018768.2-56s1c1
Sequence:CCGGCGTGTCAGATAGCCCAAGAAACTCGAGTTTCTTGGGCTATCTGACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018768.2-82s1c1
Sequence:CCGGGAGAAGATTCAAGAACGAAATCTCGAGATTTCGTTCTTGAATCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018768.2-294s1c1
Sequence:CCGGGCTCCTGGCATCGTTTAAGAACTCGAGTTCTTAAACGATGCCAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018768.2-648s1c1
Sequence:CCGGGTCAACTTCCTGTGGGATGATCTCGAGATCATCCCACAGGAAGTTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018768.2-648s21c1
Sequence:CCGGGTCAACTTCCTGTGGGATGATCTCGAGATCATCCCACAGGAAGTTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018768.2-294s21c1
Sequence:CCGGGCTCCTGGCATCGTTTAAGAACTCGAGTTCTTAAACGATGCCAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018768.2-82s21c1
Sequence:CCGGGAGAAGATTCAAGAACGAAATCTCGAGATTTCGTTCTTGAATCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018768.2-485s21c1
Sequence:CCGGATGCCCTTTCCTCTATCATAACTCGAGTTATGATAGAGGAAAGGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307419    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018768.2-1227s21c1
Sequence:CCGGCCCAACAGTGCTGGCTATTTCCTCGAGGAAATAGCCAGCACTGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018768
VALIDATED
STX8 MISSION shRNA shRNA Plasmid DNA
syntaxin 8
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000100870    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018768.2-917s1c1
Sequence:CCGGCCCTGTCTTCTGTCAGTGATTCTCGAGAATCACTGACAGAAGACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100871    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018768.2-56s1c1
Sequence:CCGGCGTGTCAGATAGCCCAAGAAACTCGAGTTTCTTGGGCTATCTGACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018768.2-82s1c1
Sequence:CCGGGAGAAGATTCAAGAACGAAATCTCGAGATTTCGTTCTTGAATCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018768.2-294s1c1
Sequence:CCGGGCTCCTGGCATCGTTTAAGAACTCGAGTTCTTAAACGATGCCAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018768.2-648s1c1
Sequence:CCGGGTCAACTTCCTGTGGGATGATCTCGAGATCATCCCACAGGAAGTTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018768.2-648s21c1
Sequence:CCGGGTCAACTTCCTGTGGGATGATCTCGAGATCATCCCACAGGAAGTTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018768.2-294s21c1
Sequence:CCGGGCTCCTGGCATCGTTTAAGAACTCGAGTTCTTAAACGATGCCAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018768.2-82s21c1
Sequence:CCGGGAGAAGATTCAAGAACGAAATCTCGAGATTTCGTTCTTGAATCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018768.2-485s21c1
Sequence:CCGGATGCCCTTTCCTCTATCATAACTCGAGTTATGATAGAGGAAAGGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307419    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018768.2-1227s21c1
Sequence:CCGGCCCAACAGTGCTGGCTATTTCCTCGAGGAAATAGCCAGCACTGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018768
VALIDATED
STX8 MISSION shRNA Lentiviral Transduction Particles
syntaxin 8
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000100870    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018768.2-917s1c1
Sequence:CCGGCCCTGTCTTCTGTCAGTGATTCTCGAGAATCACTGACAGAAGACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100871    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018768.2-56s1c1
Sequence:CCGGCGTGTCAGATAGCCCAAGAAACTCGAGTTTCTTGGGCTATCTGACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018768.2-82s1c1
Sequence:CCGGGAGAAGATTCAAGAACGAAATCTCGAGATTTCGTTCTTGAATCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100872    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018768.2-294s1c1
Sequence:CCGGGCTCCTGGCATCGTTTAAGAACTCGAGTTCTTAAACGATGCCAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_018768.2-648s1c1
Sequence:CCGGGTCAACTTCCTGTGGGATGATCTCGAGATCATCCCACAGGAAGTTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287275    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018768.2-648s21c1
Sequence:CCGGGTCAACTTCCTGTGGGATGATCTCGAGATCATCCCACAGGAAGTTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287274    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018768.2-294s21c1
Sequence:CCGGGCTCCTGGCATCGTTTAAGAACTCGAGTTCTTAAACGATGCCAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287339    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018768.2-82s21c1
Sequence:CCGGGAGAAGATTCAAGAACGAAATCTCGAGATTTCGTTCTTGAATCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294842    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018768.2-485s21c1
Sequence:CCGGATGCCCTTTCCTCTATCATAACTCGAGTTATGATAGAGGAAAGGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307419    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018768.2-1227s21c1
Sequence:CCGGCCCAACAGTGCTGGCTATTTCCTCGAGGAAATAGCCAGCACTGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004853
VALIDATED
STX8 MISSION shRNA Bacterial Glycerol Stock
syntaxin 8
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000059828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004853.1-199s1c1
Sequence:CCGGGCCCAAGAAATTGCTGAGAAACTCGAGTTTCTCAGCAATTTCTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004853.1-657s1c1
Sequence:CCGGGCAGGAAATTGGGAATGAATTCTCGAGAATTCATTCCCAATTTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004853.1-273s1c1
Sequence:CCGGCGTGACAATCAGAGCTTTGTTCTCGAGAACAAAGCTCTGATTGTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004853.1-343s1c1
Sequence:CCGGGCTGTGTCAACACATCAGATACTCGAGTATCTGATGTGTTGACACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004853.1-626s1c1
Sequence:CCGGCCTCTATCATAAGTCGCCAAACTCGAGTTTGGCGACTTATGATAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004853.1-379s21c1
Sequence:GTACCGGGACCGAAGACAGAACCTCTTGCTCGAGCAAGAGGTTCTGTCTTCGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299708    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_004853.1-273s21c1
Sequence:CCGGCGTGACAATCAGAGCTTTGTTCTCGAGAACAAAGCTCTGATTGTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004853.1-657s21c1
Sequence:CCGGGCAGGAAATTGGGAATGAATTCTCGAGAATTCATTCCCAATTTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_004853.1-626s21c1
Sequence:CCGGCCTCTATCATAAGTCGCCAAACTCGAGTTTGGCGACTTATGATAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004853.1-422s21c1
Sequence:GTACCGGGACTACTTCTGGCATCCTTTACTCGAGTAAAGGATGCCAGAAGTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004853.1-451s21c1
Sequence:GTACCGGGGTGCCGAACCAGATCTAATCCTCGAGGATTAGATCTGGTTCGGCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000310488    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_004853.1-343s21c1
Sequence:CCGGGCTGTGTCAACACATCAGATACTCGAGTATCTGATGTGTTGACACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004853.1-177s21c1
Sequence:GTACCGGATACGATTCTACTTGTCAAATCTCGAGATTTGACAAGTAGAATCGTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004853
VALIDATED
STX8 MISSION shRNA shRNA Plasmid DNA
syntaxin 8
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000059828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004853.1-199s1c1
Sequence:CCGGGCCCAAGAAATTGCTGAGAAACTCGAGTTTCTCAGCAATTTCTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004853.1-657s1c1
Sequence:CCGGGCAGGAAATTGGGAATGAATTCTCGAGAATTCATTCCCAATTTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004853.1-273s1c1
Sequence:CCGGCGTGACAATCAGAGCTTTGTTCTCGAGAACAAAGCTCTGATTGTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004853.1-343s1c1
Sequence:CCGGGCTGTGTCAACACATCAGATACTCGAGTATCTGATGTGTTGACACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004853.1-626s1c1
Sequence:CCGGCCTCTATCATAAGTCGCCAAACTCGAGTTTGGCGACTTATGATAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004853.1-379s21c1
Sequence:GTACCGGGACCGAAGACAGAACCTCTTGCTCGAGCAAGAGGTTCTGTCTTCGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299708    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_004853.1-273s21c1
Sequence:CCGGCGTGACAATCAGAGCTTTGTTCTCGAGAACAAAGCTCTGATTGTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004853.1-657s21c1
Sequence:CCGGGCAGGAAATTGGGAATGAATTCTCGAGAATTCATTCCCAATTTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_004853.1-626s21c1
Sequence:CCGGCCTCTATCATAAGTCGCCAAACTCGAGTTTGGCGACTTATGATAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004853.1-422s21c1
Sequence:GTACCGGGACTACTTCTGGCATCCTTTACTCGAGTAAAGGATGCCAGAAGTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004853.1-451s21c1
Sequence:GTACCGGGGTGCCGAACCAGATCTAATCCTCGAGGATTAGATCTGGTTCGGCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000310488    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_004853.1-343s21c1
Sequence:CCGGGCTGTGTCAACACATCAGATACTCGAGTATCTGATGTGTTGACACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004853.1-177s21c1
Sequence:GTACCGGATACGATTCTACTTGTCAAATCTCGAGATTTGACAAGTAGAATCGTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004853
VALIDATED
STX8 MISSION shRNA Lentiviral Transduction Particles
syntaxin 8
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000059828    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004853.1-199s1c1
Sequence:CCGGGCCCAAGAAATTGCTGAGAAACTCGAGTTTCTCAGCAATTTCTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004853.1-657s1c1
Sequence:CCGGGCAGGAAATTGGGAATGAATTCTCGAGAATTCATTCCCAATTTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059832    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004853.1-273s1c1
Sequence:CCGGCGTGACAATCAGAGCTTTGTTCTCGAGAACAAAGCTCTGATTGTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004853.1-343s1c1
Sequence:CCGGGCTGTGTCAACACATCAGATACTCGAGTATCTGATGTGTTGACACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059829    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004853.1-626s1c1
Sequence:CCGGCCTCTATCATAAGTCGCCAAACTCGAGTTTGGCGACTTATGATAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381903    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004853.1-379s21c1
Sequence:GTACCGGGACCGAAGACAGAACCTCTTGCTCGAGCAAGAGGTTCTGTCTTCGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299708    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_004853.1-273s21c1
Sequence:CCGGCGTGACAATCAGAGCTTTGTTCTCGAGAACAAAGCTCTGATTGTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299720    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004853.1-657s21c1
Sequence:CCGGGCAGGAAATTGGGAATGAATTCTCGAGAATTCATTCCCAATTTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_004853.1-626s21c1
Sequence:CCGGCCTCTATCATAAGTCGCCAAACTCGAGTTTGGCGACTTATGATAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004853.1-422s21c1
Sequence:GTACCGGGACTACTTCTGGCATCCTTTACTCGAGTAAAGGATGCCAGAAGTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004853.1-451s21c1
Sequence:GTACCGGGGTGCCGAACCAGATCTAATCCTCGAGGATTAGATCTGGTTCGGCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000310488    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_004853.1-343s21c1
Sequence:CCGGGCTGTGTCAACACATCAGATACTCGAGTATCTGATGTGTTGACACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004853.1-177s21c1
Sequence:GTACCGGATACGATTCTACTTGTCAAATCTCGAGATTTGACAAGTAGAATCGTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks